Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32021
Trapped Gene
Gm484 (ENSMUSG00000070564)
Vector Insertion
Chr 7: 52939869 - 52941550
Public Clones IST10211F12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000634786 (Chr7:52939784..52939868 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000634786 (Chr7:52939784..52939868 +)
Downstram Exon
ENSMUSE00000594551 (Chr7:52941551..52942195 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634786 Chr7:52939784..52939868 No primer for this exon

*** Putative Vector Insertion (Chr 7: 52939869 - 52941550) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000594551 Chr7:52941551..52942195 No primer for this exon
downstream ENSMUSE00000594549 Chr7:52946782..52946931 No primer for this exon
downstream ENSMUSE00000594548 Chr7:52947254..52947307 No primer for this exon
downstream ENSMUSE00000594545 Chr7:52947711..52947791 No primer for this exon
downstream ENSMUSE00000674288 Chr7:52949366..52949924 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGCCCTAATAGCCAGGTAG Chr7:52939889..52939909 59.94 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCCCTAATAGCCAGGTAG Chr7:52939889..52939909 59.94 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070564