Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32022
Trapped Gene
6030429G01Rik (ENSMUSG00000055809)
Vector Insertion
Chr 7: 4475745 - 4478134
Public Clones IST14463E4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000419673 (Chr7:4478016..4478133 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACAGAGCTGTTCCGAGAAG Chr7:4478085..4478104 58.75 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000419673 (Chr7:4478016..4478133 -)
Downstram Exon
ENSMUSE00000419667 (Chr7:4475746..4475857 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACAGAGCTGTTCCGAGAAG Chr7:4478085..4478104 58.75 55 GTCTGCGAAGAATCGAGAGG Chr7:4475781..4475800 60.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000637535 Chr7:4483980..4484044 AGCACAGGACCCTACCTACG Chr7:4483999..4484018 59.23 60
upstream ENSMUSE00000419733 Chr7:4483789..4483877 GGCACCGGTTATGGTAGTGT Chr7:4483833..4483852 59.74 55
upstream ENSMUSE00000601151 Chr7:4483340..4483482 GATGCCCTGCTGTTAGGTTC Chr7:4483407..4483426 59.7 55
upstream ENSMUSE00000419700 Chr7:4482376..4482469 GTAGCCCGACACATGCTGAT Chr7:4482420..4482439 61.1 55
upstream ENSMUSE00000419696 Chr7:4479555..4479712 TGGCTAATCTGGTCCTGGAG Chr7:4479606..4479625 60.21 55
upstream ENSMUSE00000419689 Chr7:4479044..4479226 ACTACCTGGGTTCCCGCTAC Chr7:4479101..4479120 60.38 60
upstream ENSMUSE00000419683 Chr7:4478696..4478821 CAACAGGACTCTGGCATCAG Chr7:4478713..4478732 59.42 55
upstream ENSMUSE00000419678 Chr7:4478469..4478591 CCTCTTACGGACGAGAAACG Chr7:4478483..4478502 59.87 55
upstream ENSMUSE00000419673 Chr7:4478016..4478133 CACAGAGCTGTTCCGAGAAG Chr7:4478085..4478104 58.75 55
upstream ENSMUSE00000419667 Chr7:4475746..4475857 TCCAGCTCCTCTACGTGTCC Chr7:4475751..4475770 60.41 60

*** Putative Vector Insertion (Chr 7: 4475745 - 4478134) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000419662 Chr7:4475540..4475614 AGCTCAGGGCTGAGAAGATG Chr7:4475566..4475585 59.7 55
downstream ENSMUSE00000538549 Chr7:4474576..4475461 CAGAGAACGCCTTCAACTCC Chr7:4475396..4475415 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCGAGAAGTAATCGCCTTG Chr7:4478072..4478092 60.34 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000055809