Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32048
Trapped Gene
Mrpl52 (ENSMUSG00000010406)
Vector Insertion
Chr 14: 55045798 - 55045870
Public Clones IST10655G6 (tigm) IST10435C8 (tigm) IST14581D12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000124124 (Chr14:55045747..55045797 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000124124 (Chr14:55045747..55045797 +)
Downstram Exon
ENSMUSE00000124125 (Chr14:55045871..55045928 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000124124 Chr14:55045747..55045797 No primer for this exon

*** Putative Vector Insertion (Chr 14: 55045798 - 55045870) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000124125 Chr14:55045871..55045928 No primer for this exon
downstream ENSMUSE00000124127 Chr14:55046008..55046075 No primer for this exon
downstream ENSMUSE00000124126 Chr14:55047421..55047485 No primer for this exon
downstream ENSMUSE00000124123 Chr14:55048419..55048590 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTGTCCAGTGAGTGATTG Chr14:55045790..55045810 59.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTGTCCAGTGAGTGATTG Chr14:55045790..55045810 59.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000010406