Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32050
Trapped Gene
Mapre2 (ENSMUSG00000024277)
Vector Insertion
Chr 18: 23931161 - 23962484
Public Clones IST14100C10 (tigm) IST12259A8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000717954 (Chr18:23931105..23931160 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCACCATTCACTTCAACAGC Chr18:23931116..23931135 59.3 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000717954 (Chr18:23931105..23931160 +)
Downstram Exon
ENSMUSE00000406670 (Chr18:23962485..23962722 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCACCATTCACTTCAACAGC Chr18:23931116..23931135 59.3 50 GCTTCCGGAAAGGAATGATA Chr18:23962697..23962716 59.12 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711127 Chr18:23910894..23910921 No primer for this exon
upstream ENSMUSE00000704321 Chr18:23912226..23912370 GCCCTAGCTTAGGTGCAAGA Chr18:23912229..23912248 59.62 55
upstream ENSMUSE00000704320 Chr18:23931105..23931160 GCACCATTCACTTCAACAGC Chr18:23931116..23931135 59.3 50
upstream ENSMUSE00000717954 Chr18:23931105..23931160 GCACCATTCACTTCAACAGC Chr18:23931116..23931135 59.3 50

*** Putative Vector Insertion (Chr 18: 23931161 - 23962484) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000406670 Chr18:23962485..23962722 GCTTCCGGAAAGGAATGATA Chr18:23962697..23962716 59.12 45
downstream ENSMUSE00000708972 Chr18:23962485..23962722 GCTTCCGGAAAGGAATGATA Chr18:23962697..23962716 59.12 45
downstream ENSMUSE00000520294 Chr18:23991354..23991481 TCATTGACCCATGCAATGAT Chr18:23991440..23991459 59.74 40
downstream ENSMUSE00000521179 Chr18:24012155..24012300 TCATGCTCCAACTTTGCTTG Chr18:24012245..24012264 59.99 45
downstream ENSMUSE00000140411 Chr18:24016445..24016658 GATCGTACTCCTTCCCGTCA Chr18:24016556..24016575 60.07 55
downstream ENSMUSE00000716749 Chr18:24016445..24019138 TCAGAGTTCAGCGCTCTTCA Chr18:24018400..24018419 60.01 50
downstream ENSMUSE00000140410 Chr18:24036445..24036584 TCCTGGCTTAGATGCAGGAC Chr18:24036482..24036501 60.36 55
downstream ENSMUSE00000343422 Chr18:24042039..24042197 GTTCATCGGAAGCGTAGAGC Chr18:24042198..24042217 59.99 55
downstream ENSMUSE00000518314 Chr18:24049358..24052354 GACTCGCAAACATCAAAGCA Chr18:24049880..24049899 59.99 45
downstream ENSMUSE00000704319 Chr18:24049358..24050865 GACTCGCAAACATCAAAGCA Chr18:24049880..24049899 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCCTCCTTCCCAATTCAAC Chr18:23949185..23949205 60.17 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCCTCCTTCCCAATTCAAC Chr18:23949185..23949205 60.17 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024277