Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32064
Trapped Gene
Cacng8 (ENSMUSG00000053395)
Vector Insertion
Chr 7: 3394847 - 3411538
Public Clones IST14233H5 (tigm) IST14798E5 (tigm) IST12963C7 (tigm) IST14080A6 (tigm)
IST10873D4 (tigm) IST11030A10 (tigm) IST14823B2 (tigm) IST14233H5 (tigm)
IST11030A10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 42% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000444958 (Chr7:3394459..3394846 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGAAAAGGGCGTTCAGGTA Chr7:3394610..3394629 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000444958 (Chr7:3394459..3394846 +)
Downstram Exon
ENSMUSE00000444940 (Chr7:3411539..3411622 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGAAAAGGGCGTTCAGGTA Chr7:3394610..3394629 60.11 50 GTGGTCGTAGTCCGTGTCCT Chr7:3411603..3411622 60.03 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000444958 Chr7:3394459..3394846 GTGAAAAGGGCGTTCAGGTA Chr7:3394610..3394629 60.11 50

*** Putative Vector Insertion (Chr 7: 3394847 - 3411538) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000444940 Chr7:3411539..3411622 GTGGTCGTAGTCCGTGTCCT Chr7:3411603..3411622 60.03 60
downstream ENSMUSE00000444935 Chr7:3412431..3412522 No primer for this exon
downstream ENSMUSE00000488528 Chr7:3412527..3412573 GCCCAGGATGATGTTCCTTT Chr7:3412550..3412569 61.22 50
downstream ENSMUSE00000575094 Chr7:3415207..3415366 ACCAGCCGTACGAGTAGTGG Chr7:3415313..3415332 60.19 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTCACACATTCAGGCCTCT Chr7:3400807..3400827 60.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAGGTAGGGTGCAGGAAG Chr7:3397843..3397863 61.01 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053395