Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32067
Trapped Gene
Map3k4 (ENSMUSG00000014426)
Vector Insertion
Chr 17: 12429846 - 12431097
Public Clones IST13054G9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000247740 (Chr17:12430905..12431096 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000247740 (Chr17:12430905..12431096 -)
Downstram Exon
ENSMUSE00000247722 (Chr17:12429847..12429917 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000503769 Chr17:12511364..12511614 No primer for this exon
upstream ENSMUSE00000248177 Chr17:12470787..12470977 No primer for this exon
upstream ENSMUSE00000556030 Chr17:12463729..12465086 No primer for this exon
upstream ENSMUSE00000135609 Chr17:12456772..12457014 No primer for this exon
upstream ENSMUSE00000248099 Chr17:12454110..12454256 No primer for this exon
upstream ENSMUSE00000248070 Chr17:12453317..12453474 No primer for this exon
upstream ENSMUSE00000248052 Chr17:12450780..12450896 No primer for this exon
upstream ENSMUSE00000135594 Chr17:12449628..12449727 No primer for this exon
upstream ENSMUSE00000135589 Chr17:12449457..12449540 No primer for this exon
upstream ENSMUSE00000135600 Chr17:12447863..12448129 No primer for this exon
upstream ENSMUSE00000135598 Chr17:12446948..12447097 No primer for this exon
upstream ENSMUSE00000135603 Chr17:12442363..12442524 No primer for this exon
upstream ENSMUSE00000135588 Chr17:12441770..12441903 No primer for this exon
upstream ENSMUSE00000135593 Chr17:12440919..12440997 No primer for this exon
upstream ENSMUSE00000135597 Chr17:12440169..12440235 No primer for this exon
upstream ENSMUSE00000135604 Chr17:12436366..12436462 No primer for this exon
upstream ENSMUSE00000135592 Chr17:12435516..12435671 No primer for this exon
upstream ENSMUSE00000135591 Chr17:12432836..12432936 No primer for this exon
upstream ENSMUSE00000247757 Chr17:12432245..12432325 No primer for this exon
upstream ENSMUSE00000247740 Chr17:12430905..12431096 No primer for this exon
upstream ENSMUSE00000247722 Chr17:12429847..12429917 No primer for this exon

*** Putative Vector Insertion (Chr 17: 12429846 - 12431097) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000247699 Chr17:12428765..12428881 No primer for this exon
downstream ENSMUSE00000135601 Chr17:12427917..12428076 No primer for this exon
downstream ENSMUSE00000135587 Chr17:12425780..12425902 No primer for this exon
downstream ENSMUSE00000135596 Chr17:12425278..12425384 No primer for this exon
downstream ENSMUSE00000247627 Chr17:12422383..12422562 No primer for this exon
downstream ENSMUSE00000703857 Chr17:12420489..12420986 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGACTTGCCTACATTCTGG Chr17:12431122..12431142 60.65 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGACTTGCCTACATTCTGG Chr17:12431122..12431142 60.65 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014426