Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32073
Trapped Gene
Gpc5 (ENSMUSG00000022112)
Vector Insertion
Chr 14: 116187555 - 116923501
Public Clones IST14199E7 (tigm) IST11843A10 (tigm) IST12524D9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000474857 (Chr14:116187395..116187554 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGATCAGGAAGCGGAGAAGT Chr14:116187509..116187528 60.74 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000474857 (Chr14:116187395..116187554 +)
Downstram Exon
ENSMUSE00000466876 (Chr14:116923502..116923659 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGATCAGGAAGCGGAGAAGT Chr14:116187509..116187528 60.74 55 GACTCAGTTCCTGACGCACA Chr14:116923610..116923629 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000473073 Chr14:115491848..115492010 CTGCGAAGAAGTTCGGAAAC Chr14:115491934..115491953 59.99 50
upstream ENSMUSE00000472170 Chr14:115532369..115532530 AAAACCCAACGTGCTGTACC Chr14:115532396..115532415 59.9 50
upstream ENSMUSE00000685146 Chr14:115768753..115769448 TTCTTGCAGGCGCTTAATCT Chr14:115769101..115769120 60.12 45
upstream ENSMUSE00000418620 Chr14:115768754..115769448 TTCTTGCAGGCGCTTAATCT Chr14:115769101..115769120 60.12 45
upstream ENSMUSE00000418605 Chr14:115798368..115798501 AATACGATTTGTGGCCATCC Chr14:115798371..115798390 59.65 45
upstream ENSMUSE00000552710 Chr14:115816365..115816488 GAAGCTGGCTCGAATCCATA Chr14:115816407..115816426 60.32 50
upstream ENSMUSE00000123709 Chr14:115827361..115827486 TGCATGGGTCCTTCTATGGT Chr14:115827384..115827403 60.34 50
upstream ENSMUSE00000468040 Chr14:115951437..115951557 GAGGAACCGATCCTGTGGTA Chr14:115951502..115951521 59.93 55
upstream ENSMUSE00000474857 Chr14:116187395..116187554 GGATCAGGAAGCGGAGAAGT Chr14:116187509..116187528 60.74 55

*** Putative Vector Insertion (Chr 14: 116187555 - 116923501) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000466876 Chr14:116923502..116923659 GACTCAGTTCCTGACGCACA Chr14:116923610..116923629 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGAGTGCAAGCATCGAGAG Chr14:116346556..116346576 59.73 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGAGTGCAAGCATCGAGAG Chr14:116346556..116346576 59.73 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022112