Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32079
Trapped Gene
2810030E01Rik (ENSMUSG00000054074)
Vector Insertion
Chr 2: 17969295 - 17970679
Public Clones (cmhd) IST12018E5 (tigm) IST14591B10 (tigm) IST13680E12 (tigm) IST14859B10 (tigm)
IST11551F11 (tigm) IST14634F11 (tigm) IST10416E9 (tigm) IST12018E5 (tigm)
IST14703A4 (tigm) IST13791F1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000700266 (Chr2:17970670..17970678 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000700266 (Chr2:17970670..17970678 -)
Downstram Exon
ENSMUSE00000429410 (Chr2:17969296..17970076 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CAGCAGGCTCCGAAAATAAG Chr2:17969291..17969310 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700266 Chr2:17970670..17970678 No primer for this exon
upstream ENSMUSE00000569880 Chr2:17969298..17969966 CTTATTTTCGGAGCCTGCTG Chr2:17969313..17969332 59.97 50
upstream ENSMUSE00000429410 Chr2:17969296..17970076 CTTATTTTCGGAGCCTGCTG Chr2:17969313..17969332 59.97 50

*** Putative Vector Insertion (Chr 2: 17969295 - 17970679) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000429402 Chr2:17967237..17969036 CTCCTCCGAGCTGATTTCAC Chr2:17968628..17968647 59.95 55
downstream ENSMUSE00000569881 Chr2:17965710..17969034 CTCCTCCGAGCTGATTTCAC Chr2:17968628..17968647 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATAATCGCCTTGCAGCACA Chr2:17970610..17970630 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGAACGTGACTGGGAAAA Chr2:17970614..17970634 60.35 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054074