Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32085
Trapped Gene
D430028G21Rik (ENSMUSG00000037523)
Vector Insertion
Chr 2: 131060092 - 131064471
Public Clones IST14181A7 (tigm) IST10454E11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000683105 (Chr2:131059841..131060091 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCCAGCACCTTTAGCAAGC Chr2:131060070..131060089 59.48 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000683105 (Chr2:131059841..131060091 +)
Downstram Exon
ENSMUSE00000255128 (Chr2:131064472..131064646 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCCAGCACCTTTAGCAAGC Chr2:131060070..131060089 59.48 50 TGCTGTGGTTGTCTCGGATA Chr2:131064584..131064603 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000596279 Chr2:131059803..131059863 CGGTCAACCTGTTGCCTAGT Chr2:131059831..131059850 60.17 55
upstream ENSMUSE00000683105 Chr2:131059841..131060091 ATCCAGCACCTTTAGCAAGC Chr2:131060070..131060089 59.48 50

*** Putative Vector Insertion (Chr 2: 131060092 - 131064471) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000255128 Chr2:131064472..131064646 TGCTGTGGTTGTCTCGGATA Chr2:131064584..131064603 60.26 50
downstream ENSMUSE00000721821 Chr2:131064472..131064646 TGCTGTGGTTGTCTCGGATA Chr2:131064584..131064603 60.26 50
downstream ENSMUSE00000255119 Chr2:131066051..131066228 GGCGCTGGAGATTATTGAAG Chr2:131066129..131066148 59.81 50
downstream ENSMUSE00000255110 Chr2:131067616..131067785 GGTCAGGGATGTTGTGACCT Chr2:131067717..131067736 59.82 55
downstream ENSMUSE00000255101 Chr2:131068855..131069008 TGGTCTGGAGGAGTTGCTCT Chr2:131068882..131068901 59.99 55
downstream ENSMUSE00000255095 Chr2:131070939..131071405 GGTAATTTTGATGGCGCTGT Chr2:131071302..131071321 59.97 45
downstream ENSMUSE00000355802 Chr2:131072100..131073761 CCTCCAGTGGTGACTTTGGT Chr2:131072143..131072162 60 55
downstream ENSMUSE00000683086 Chr2:131072100..131073756 CCTCCAGTGGTGACTTTGGT Chr2:131072143..131072162 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGGCTGGACAGAAAGAAC Chr2:131060115..131060135 59.84 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAAGAACCTCGGAGTCGTG Chr2:131060127..131060147 59.84 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037523