Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32088
Trapped Gene
Ccnt1 (ENSMUSG00000011960)
Vector Insertion
Chr 15: 98397906 - 98401355
Public Clones IST14371A1 (tigm) IST13985D12 (tigm) IST14656D6 (tigm) IST13177A2 (tigm)
IST14656D6 (tigm) IST13963D5 (tigm) IST14573G11 (tigm) IST13177A2 (tigm)
IST10033F12 (tigm) IST13985D12 (tigm) IST13388F2 (tigm) IST13830A6 (tigm)
IST11526C5 (tigm) IST13963D5 (tigm) IST14808E7 (tigm) IST14371A1 (tigm)
IST14340C12 (tigm) IST13503F6 (tigm) IST12670B7 (tigm) IST14561E7 (tigm)
IST14808E7 (tigm) IST13764B9 (tigm) IST14573G11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000679188 (Chr15:98401302..98401354 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000679188 (Chr15:98401302..98401354 -)
Downstram Exon
ENSMUSE00000368014 (Chr15:98397907..98398714 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000679188 Chr15:98401302..98401354 No primer for this exon
upstream ENSMUSE00000368014 Chr15:98397907..98398714 No primer for this exon

*** Putative Vector Insertion (Chr 15: 98397906 - 98401355) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000132453 Chr15:98395478..98395559 No primer for this exon
downstream ENSMUSE00000132454 Chr15:98390628..98390756 No primer for this exon
downstream ENSMUSE00000132447 Chr15:98385032..98385092 No primer for this exon
downstream ENSMUSE00000132446 Chr15:98382345..98382407 No primer for this exon
downstream ENSMUSE00000132451 Chr15:98379097..98379142 No primer for this exon
downstream ENSMUSE00000132450 Chr15:98377176..98377339 No primer for this exon
downstream ENSMUSE00000270648 Chr15:98376955..98377025 No primer for this exon
downstream ENSMUSE00000270638 Chr15:98373642..98375039 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr15:98401285..98401305 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGCTCGTGACTGGGAAAA Chr15:98401290..98401310 60.38 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000011960