Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32092
Trapped Gene
Acsbg2 (ENSMUSG00000024207)
Vector Insertion
Chr 17: 57003882 - 57007879
Public Clones IST13111H11 (tigm) IST12499G6 (tigm) IST10320A6 (tigm) IST10106G3 (tigm)
IST14717H10 (tigm) IST14814C8 (tigm) IST10891D3 (tigm) IST12499G6 (tigm)
IST12275F2 (tigm) IST12443B11 (tigm) IST12275F2 (tigm) IST12013H1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000606652 (Chr17:57007649..57007878 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTCAAAGAACGGCAAAAAG Chr17:57007715..57007734 59.85 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000606652 (Chr17:57007649..57007878 -)
Downstram Exon
ENSMUSE00000606651 (Chr17:57003883..57003971 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTCAAAGAACGGCAAAAAG Chr17:57007715..57007734 59.85 45 CCACTCGACCGAGTTAAAGC Chr17:57003893..57003912 59.88 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000606654 Chr17:57013620..57013870 CTGGCCACCTTGTGAAAGTT Chr17:57013621..57013640 60.15 50
upstream ENSMUSE00000606653 Chr17:57012220..57012320 GAGAAGAAGGCGGAAGACCT Chr17:57012246..57012265 59.96 55
upstream ENSMUSE00000606652 Chr17:57007649..57007878 CCTCAAAGAACGGCAAAAAG Chr17:57007715..57007734 59.85 45
upstream ENSMUSE00000606651 Chr17:57003883..57003971 GGTCGAGTGGGTCGTTACTG Chr17:57003905..57003924 60.57 60

*** Putative Vector Insertion (Chr 17: 57003882 - 57007879) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000606650 Chr17:57002294..57002414 GATACTCACGTTGGCCTGCT Chr17:57002314..57002333 60.28 55
downstream ENSMUSE00000693748 Chr17:57002290..57002414 GATACTCACGTTGGCCTGCT Chr17:57002314..57002333 60.28 55
downstream ENSMUSE00000693747 Chr17:57002084..57002091 No primer for this exon
downstream ENSMUSE00000606649 Chr17:57000962..57001045 ACAATGGCTTTCACGGTCTC Chr17:57000986..57001005 60.12 50
downstream ENSMUSE00000693746 Chr17:57000962..57001030 ACAATGGCTTTCACGGTCTC Chr17:57000986..57001005 60.12 50
downstream ENSMUSE00000463791 Chr17:56996302..56996451 TTGGGATGTCATTCCCTAGC Chr17:56996393..56996412 59.89 50
downstream ENSMUSE00000139734 Chr17:56993160..56993336 CTGAGTGCATCTGGTTGAGC Chr17:56993139..56993158 59.58 55
downstream ENSMUSE00000139739 Chr17:56989458..56989639 TTGAAGCGTGTACACCAAGG Chr17:56989594..56989613 59.76 50
downstream ENSMUSE00000139742 Chr17:56989138..56989371 CGGTAATTCATGGGGATGTC Chr17:56989323..56989342 60.01 50
downstream ENSMUSE00000139735 Chr17:56987034..56987251 GCGGCCAGTGATATAAAGGA Chr17:56987019..56987038 60.06 50
downstream ENSMUSE00000139740 Chr17:56985945..56986084 CACCAGCGGTTATCAGGATT Chr17:56986042..56986061 59.96 50
downstream ENSMUSE00000139736 Chr17:56985516..56985762 GATGGCCGTGTAGACCACTT Chr17:56985600..56985619 60 55
downstream ENSMUSE00000139733 Chr17:56984827..56984936 No primer for this exon
downstream ENSMUSE00000606648 Chr17:56982527..56982800 AGGAAGGTGTTTTGGGCTCT Chr17:56982548..56982567 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAGCTGTTCCCAGGCTATG Chr17:57007861..57007881 60.28 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAGCTGTTCCCAGGCTATG Chr17:57007861..57007881 60.28 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024207