Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32094
Trapped Gene
AC129222.4-202 (ENSMUSG00000058570)
Vector Insertion
Chr 14: 8609024 - 8621169
Public Clones IST14001F11 (tigm) IST14671H6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000306572 (Chr14:8620995..8621168 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAAACACTGCCCTCCACTA Chr14:8621071..8621090 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000306572 (Chr14:8620995..8621168 -)
Downstram Exon
ENSMUSE00000565309 (Chr14:8609025..8609326 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAAACACTGCCCTCCACTA Chr14:8621071..8621090 60.11 55 TCAAAGGGTTCAGGAAATGC Chr14:8609049..8609068 60.05 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000711789 Chr14:8623922..8624104 CCCAGATACCTCGCTGGATA Chr14:8624033..8624052 60.05 55
upstream ENSMUSE00000306576 Chr14:8622532..8622646 CAACTGCACGCCTCTCATTA Chr14:8622534..8622553 60.01 50
upstream ENSMUSE00000306572 Chr14:8620995..8621168 GGAAACACTGCCCTCCACTA Chr14:8621071..8621090 60.11 55
upstream ENSMUSE00000565309 Chr14:8609025..8609326 GCAGGACATAGACCTGCACA Chr14:8609173..8609192 59.86 55

*** Putative Vector Insertion (Chr 14: 8609024 - 8621169) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000708370 Chr14:8603655..8603816 TCTCCCGGAAAATAGCCTTT Chr14:8603729..8603748 60.03 45
downstream ENSMUSE00000565306 Chr14:8598729..8598762 No primer for this exon
downstream ENSMUSE00000565305 Chr14:8597296..8597368 CACCGTTGATTTGCTTCTTG Chr14:8597325..8597344 59.32 45
downstream ENSMUSE00000650969 Chr14:8589507..8589619 TCTTGCAACTGTGCTTCCTG Chr14:8589575..8589594 60.17 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATAATCGCCTTGCAGCACA Chr14:8618100..8618120 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACACCAGTGGCTTTCTTCC Chr14:8609197..8609217 59.19 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058570