Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32100
Trapped Gene
Dlgap1 (ENSMUSG00000003279)
Vector Insertion
Chr 17: 71158620 - 71164533
Public Clones IST10086B11 (tigm) IST10086B11 (tigm) IST10990F2 (tigm) IST12845A7 (tigm)
IST13097E3 (tigm) IST12206C12 (tigm) IST10989E3 (tigm) IST14249H2 (tigm)
IST13097E3 (tigm) IST11006C4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000353149 (Chr17:71158528..71158619 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000353149 (Chr17:71158528..71158619 +)
Downstram Exon
ENSMUSE00000137561 (Chr17:71164534..71164686 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000411615 Chr17:70318586..70319010 No primer for this exon
upstream ENSMUSE00000692672 Chr17:70427602..70427763 No primer for this exon
upstream ENSMUSE00000692665 Chr17:70555577..70555685 No primer for this exon
upstream ENSMUSE00000692663 Chr17:70657387..70657510 No primer for this exon
upstream ENSMUSE00000692659 Chr17:70774136..70774228 No primer for this exon
upstream ENSMUSE00000369734 Chr17:70865294..70866336 No primer for this exon
upstream ENSMUSE00000692632 Chr17:70911127..70911211 No primer for this exon
upstream ENSMUSE00000422422 Chr17:70942507..70942721 No primer for this exon
upstream ENSMUSE00000422417 Chr17:71006794..71006971 No primer for this exon
upstream ENSMUSE00000354741 Chr17:71011909..71012149 No primer for this exon
upstream ENSMUSE00000399544 Chr17:71067536..71067565 No primer for this exon
upstream ENSMUSE00000361534 Chr17:71110415..71110785 No primer for this exon
upstream ENSMUSE00000407470 Chr17:71115338..71115429 No primer for this exon
upstream ENSMUSE00000348253 Chr17:71136128..71136549 No primer for this exon
upstream ENSMUSE00000353149 Chr17:71158528..71158619 No primer for this exon

*** Putative Vector Insertion (Chr 17: 71158620 - 71164533) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000137561 Chr17:71164534..71164686 No primer for this exon
downstream ENSMUSE00000692631 Chr17:71164534..71165433 No primer for this exon
downstream ENSMUSE00000657023 Chr17:71167365..71169064 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGGCGCAGAAATTCTACCA Chr17:71161573..71161593 60.61 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGCGCAGAAATTCTACCA Chr17:71161573..71161593 60.61 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003279