Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32103
Trapped Gene
9030025P20Rik (ENSMUSG00000073455)
Vector Insertion
Chr 17: 15157299 - 15158878
Public Clones IST14747E8 (tigm) IST11675C5 (tigm) IST12441D7 (tigm) IST10876F1 (tigm)
IST14873H11 (tigm) IST14747E8 (tigm) IST11504B5 (tigm) IST10296D3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000517798 (Chr17:15157230..15157298 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCATGAACCAGCTTCCTTG Chr17:15157257..15157276 60.4 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000517798 (Chr17:15157230..15157298 +)
Downstram Exon
ENSMUSE00000658231 (Chr17:15158879..15159904 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCATGAACCAGCTTCCTTG Chr17:15157257..15157276 60.4 50 GTTGATCTCCCCATGGCTTA Chr17:15158956..15158975 59.89 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000379560 Chr17:15147213..15147235 No primer for this exon
upstream ENSMUSE00000658239 Chr17:15147243..15147330 CGTCCCATCCCTTATTCTGA Chr17:15147252..15147271 59.89 50
upstream ENSMUSE00000358203 Chr17:15147837..15148005 TTACCAGGGGATTCCATGAC Chr17:15147840..15147859 59.6 50
upstream ENSMUSE00000703574 Chr17:15147837..15148005 TTACCAGGGGATTCCATGAC Chr17:15147840..15147859 59.6 50
upstream ENSMUSE00000613788 Chr17:15148594..15148733 GGCGAAGTCTGGACTACAGG Chr17:15148594..15148613 59.87 60
upstream ENSMUSE00000703573 Chr17:15148594..15148733 GGCGAAGTCTGGACTACAGG Chr17:15148594..15148613 59.87 60
upstream ENSMUSE00000613787 Chr17:15149912..15150013 CTCGGCGTGATGAAACTAGC Chr17:15149966..15149985 60.93 55
upstream ENSMUSE00000703572 Chr17:15149912..15150013 CTCGGCGTGATGAAACTAGC Chr17:15149966..15149985 60.93 55
upstream ENSMUSE00000613786 Chr17:15150636..15150725 GAAAGAGTGCCCCTTTCTCC Chr17:15150653..15150672 60.19 55
upstream ENSMUSE00000658238 Chr17:15150636..15150725 GAAAGAGTGCCCCTTTCTCC Chr17:15150653..15150672 60.19 55
upstream ENSMUSE00000658242 Chr17:15151225..15151245 No primer for this exon
upstream ENSMUSE00000613785 Chr17:15153153..15153250 GCGGACTCAACCTGAGAAAC Chr17:15153187..15153206 59.85 55
upstream ENSMUSE00000658237 Chr17:15153153..15153250 GCGGACTCAACCTGAGAAAC Chr17:15153187..15153206 59.85 55
upstream ENSMUSE00000658234 Chr17:15154105..15154241 TGGCACATCGACCTTTTGTA Chr17:15154185..15154204 60.11 45
upstream ENSMUSE00000613783 Chr17:15155049..15155163 GAGCAAGTTCAAGTCGCACA Chr17:15155143..15155162 60.18 50
upstream ENSMUSE00000613782 Chr17:15155930..15156032 GACTGCACCATGTTGTTGCT Chr17:15155937..15155956 59.76 50
upstream ENSMUSE00000658236 Chr17:15155930..15156131 TCACAGCCGAGGTACAAGTG Chr17:15156022..15156041 59.9 55
upstream ENSMUSE00000613781 Chr17:15156406..15156435 No primer for this exon
upstream ENSMUSE00000517798 Chr17:15157230..15157298 AGCATGAACCAGCTTCCTTG Chr17:15157257..15157276 60.4 50

*** Putative Vector Insertion (Chr 17: 15157299 - 15158878) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000658231 Chr17:15158879..15159904 GTTGATCTCCCCATGGCTTA Chr17:15158956..15158975 59.89 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGCTTCCTTGTTTCCTTGG Chr17:15157267..15157287 59.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGCTTCCTTGTTTCCTTGG Chr17:15157267..15157287 59.85 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000073455