Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32104
Trapped Gene
Cyp2ab1 (ENSMUSG00000022818)
Vector Insertion
Chr 16: 20308459 - 20310297
Public Clones IST15070C11 (tigm) IST15070C11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000130732 (Chr16:20310155..20310296 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGGCCACTTCCTAGACAA Chr16:20310202..20310221 60.25 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000130732 (Chr16:20310155..20310296 -)
Downstram Exon
ENSMUSE00000509134 (Chr16:20308460..20310054 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGGCCACTTCCTAGACAA Chr16:20310202..20310221 60.25 55 TTGTGGTGCAACACCTGATT Chr16:20308857..20308876 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000440479 Chr16:20322971..20323081 TTCACGTCGTGTGGTTGTCT Chr16:20322993..20323012 60.2 50
upstream ENSMUSE00000130734 Chr16:20315028..20315177 GCTTACATGGCGACAACAGA Chr16:20315139..20315158 59.87 50
upstream ENSMUSE00000317268 Chr16:20314271..20314431 TATCATCCGATCCACAACGA Chr16:20314387..20314406 59.88 45
upstream ENSMUSE00000317310 Chr16:20313801..20313974 TCTCAGGACCCCATCAGAAG Chr16:20313921..20313940 60.19 55
upstream ENSMUSE00000317305 Chr16:20313101..20313242 CCATCGATGACCCTGTCTCT Chr16:20313222..20313241 60.07 55
upstream ENSMUSE00000130731 Chr16:20312302..20312489 CTGCTATGAGGACCGAGAGC Chr16:20312421..20312440 60.12 60
upstream ENSMUSE00000130732 Chr16:20310155..20310296 CCTGGCCACTTCCTAGACAA Chr16:20310202..20310221 60.25 55
upstream ENSMUSE00000509134 Chr16:20308460..20310054 GGTGACTGCTAGTGCGTTCA Chr16:20309028..20309047 60.06 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCTGCAGGGAACCATCATC Chr16:20310283..20310303 60.62 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTGCAGGGAACCATCATC Chr16:20310283..20310303 60.62 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022818