Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32121
Trapped Gene
0610010F05Rik (ENSMUSG00000042208)
Vector Insertion
Chr 11: 23495380 - 23506767
Public Clones IST12255H1 (tigm) IST12255G1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000593556 (Chr11:23506614..23506766 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGGCACTGGAATTTATCC Chr11:23506663..23506682 59.25 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000593556 (Chr11:23506614..23506766 -)
Downstram Exon
ENSMUSE00000593555 (Chr11:23495381..23495526 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGGCACTGGAATTTATCC Chr11:23506663..23506682 59.25 50 ATTTTAGCAGGTGGGCAAGA Chr11:23495422..23495441 59.71 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680653 Chr11:23533493..23533631 No primer for this exon
upstream ENSMUSE00000680652 Chr11:23531205..23531334 No primer for this exon
upstream ENSMUSE00000593565 Chr11:23528873..23529033 GGAATCCCTCAGACCATCAA Chr11:23528919..23528938 59.86 50
upstream ENSMUSE00000593585 Chr11:23528873..23529027 GGAATCCCTCAGACCATCAA Chr11:23528919..23528938 59.86 50
upstream ENSMUSE00000680651 Chr11:23528873..23529031 GGAATCCCTCAGACCATCAA Chr11:23528919..23528938 59.86 50
upstream ENSMUSE00000593564 Chr11:23524936..23525122 TGGAGAGGGTCCTGTTGAAA Chr11:23525026..23525045 60.62 50
upstream ENSMUSE00000593584 Chr11:23524936..23525122 TGGAGAGGGTCCTGTTGAAA Chr11:23525026..23525045 60.62 50
upstream ENSMUSE00000593563 Chr11:23522436..23522529 TGCTCGTAATGCTGGAGAAG Chr11:23522455..23522474 59.17 50
upstream ENSMUSE00000593583 Chr11:23522436..23522525 TGCTCGTAATGCTGGAGAAG Chr11:23522455..23522474 59.17 50
upstream ENSMUSE00000593562 Chr11:23520229..23520467 TGCCCACGAGATCTTTTGAT Chr11:23520390..23520409 60.6 45
upstream ENSMUSE00000713402 Chr11:23520229..23520467 TGCCCACGAGATCTTTTGAT Chr11:23520390..23520409 60.6 45
upstream ENSMUSE00000715748 Chr11:23520229..23520467 TGCCCACGAGATCTTTTGAT Chr11:23520390..23520409 60.6 45
upstream ENSMUSE00000655138 Chr11:23517138..23517196 GCCAGGGAATGTCATTTCAA Chr11:23517176..23517195 60.84 45
upstream ENSMUSE00000680646 Chr11:23517138..23517196 GCCAGGGAATGTCATTTCAA Chr11:23517176..23517195 60.84 45
upstream ENSMUSE00000655136 Chr11:23515096..23515256 GCTCCATGCAACATGAACTG Chr11:23515186..23515205 60.27 50
upstream ENSMUSE00000680644 Chr11:23515096..23515256 GCTCCATGCAACATGAACTG Chr11:23515186..23515205 60.27 50
upstream ENSMUSE00000655133 Chr11:23511962..23512048 No primer for this exon
upstream ENSMUSE00000680643 Chr11:23511962..23512048 No primer for this exon
upstream ENSMUSE00000680640 Chr11:23511830..23511857 No primer for this exon
upstream ENSMUSE00000680657 Chr11:23511747..23511857 ATGTGGACCGACATGGAAAT Chr11:23511767..23511786 60.06 45
upstream ENSMUSE00000593557 Chr11:23509001..23509124 GATGTTTATTGGCGTTTGTGG Chr11:23509040..23509060 60.24 42.86
upstream ENSMUSE00000593556 Chr11:23506614..23506766 GTGGGCACTGGAATTTATCC Chr11:23506663..23506682 59.25 50
upstream ENSMUSE00000593555 Chr11:23495381..23495526 ATGATGATTCGCCTTCTTGC Chr11:23495458..23495477 60.19 45

*** Putative Vector Insertion (Chr 11: 23495380 - 23506767) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000593554 Chr11:23493426..23493525 TTCCAGGCCTTTTTCATCAC Chr11:23493464..23493483 60.05 45
downstream ENSMUSE00000593553 Chr11:23489951..23489983 TGCAGAGTCCAGTTTTTCAGTG Chr11:23489933..23489954 60.47 45.46
downstream ENSMUSE00000593552 Chr11:23488635..23488734 No primer for this exon
downstream ENSMUSE00000103071 Chr11:23484520..23484611 TTGAGAACAGGGTGAGGACA Chr11:23484522..23484541 59.23 50
downstream ENSMUSE00000103058 Chr11:23483098..23483126 No primer for this exon
downstream ENSMUSE00000103073 Chr11:23482867..23482940 GGATCTTGAGGCATCCCATT Chr11:23482879..23482898 61.2 50
downstream ENSMUSE00000103063 Chr11:23481596..23481684 GGTCCAGATCACCCAATCTC Chr11:23481600..23481619 59.31 55
downstream ENSMUSE00000103060 Chr11:23476731..23476822 GGCTCTGACTTGTGCTTCAA Chr11:23476756..23476775 59.17 50
downstream ENSMUSE00000680655 Chr11:23473903..23475517 CAACCCTTCTTGACCAGCAT Chr11:23474849..23474868 60.11 50
downstream ENSMUSE00000103075 Chr11:23473788..23475517 CAACCCTTCTTGACCAGCAT Chr11:23474849..23474868 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGAAACATTAATCGCCTTG Chr11:23500705..23500726 59.47 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGGAAACATCGTGACTGG Chr11:23503707..23503727 60.57 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042208