Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32124
Trapped Gene
Ddx6 (ENSMUSG00000032097)
Vector Insertion
Chr 9: 44438224 - 44439465
Public Clones IST13871D12 (tigm) IST12568E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 76% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000216531 (Chr9:44438107..44438223 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTCGAGCTACTCGCCAAGA Chr9:44438151..44438170 60.3 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000216531 (Chr9:44438107..44438223 +)
Downstram Exon
ENSMUSE00000473047 (Chr9:44439466..44439529 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTCGAGCTACTCGCCAAGA Chr9:44438151..44438170 60.3 55 CAAACAAGATTGCGGCATAA Chr9:44439527..44439546 59.7 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000435404 Chr9:44412979..44413035 GGGAGCTTCGAGTCAACAAT Chr9:44412979..44412998 59.29 50
upstream ENSMUSE00000260519 Chr9:44415206..44415675 CCTGTGCAGCTAACAAAGCA Chr9:44415457..44415476 60.19 50
upstream ENSMUSE00000216524 Chr9:44420911..44420974 ACCTGGTGATGACTGGAAAAA Chr9:44420911..44420931 59.44 42.86
upstream ENSMUSE00000216526 Chr9:44422295..44422399 GATGTGACCTCCACAAAAGGA Chr9:44422295..44422315 59.96 47.62
upstream ENSMUSE00000216525 Chr9:44431702..44431831 ACTTGAAAGGCTGGACCTGA Chr9:44431794..44431813 59.84 50
upstream ENSMUSE00000216535 Chr9:44432558..44432704 CACCGGAGGAACCAATTTAC Chr9:44432655..44432674 59.29 50
upstream ENSMUSE00000216528 Chr9:44434471..44434565 GGTTGACCATGTCCAGATGA Chr9:44434532..44434551 59.32 50
upstream ENSMUSE00000461271 Chr9:44435721..44435843 TGTCACAGGATTTTGTGCAGAT Chr9:44435734..44435755 60.56 40.91
upstream ENSMUSE00000216533 Chr9:44436724..44436852 ATATGTAACGGAGCGCCAAA Chr9:44436801..44436820 60.48 45
upstream ENSMUSE00000216531 Chr9:44438107..44438223 AGTCGAGCTACTCGCCAAGA Chr9:44438151..44438170 60.3 55

*** Putative Vector Insertion (Chr 9: 44438224 - 44439465) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000473047 Chr9:44439466..44439529 CAAACAAGATTGCGGCATAA Chr9:44439527..44439546 59.7 40
downstream ENSMUSE00000216530 Chr9:44442176..44442277 TAGGTCTCTGCCAGCTTTGG Chr9:44442257..44442276 60.53 55
downstream ENSMUSE00000216534 Chr9:44443766..44443948 AGGCTCTTGTCGATGTTGCT Chr9:44443895..44443914 60.02 50
downstream ENSMUSE00000637410 Chr9:44444572..44446427 CTTTACAGCGAGTGCCTTCC Chr9:44445445..44445464 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCAGCTGGGCTACTCTTGC Chr9:44438178..44438198 60.3 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCAGCTGGGCTACTCTTGC Chr9:44438178..44438198 60.3 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032097