Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32129
Trapped Gene
Ednra (ENSMUSG00000031616)
Vector Insertion
Chr 8: 80212967 - 80244402
Public Clones IST13232G8 (tigm) IST10478H1 (tigm) IST14997C12 (tigm) IST12129C8 (tigm)
IST10709B5 (tigm) IST14156B10 (tigm) IST14307D1 (tigm) IST12129C8 (tigm)
IST11461C2 (tigm) IST10599E3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 33% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000249488 (Chr8:80243927..80244401 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGCGTAATGGCTGACAAT Chr8:80244281..80244300 60.1 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000249488 (Chr8:80243927..80244401 -)
Downstram Exon
ENSMUSE00000249482 (Chr8:80212968..80213095 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGCGTAATGGCTGACAAT Chr8:80244281..80244300 60.1 50 GAGGTTCAAGACGGTGATGC Chr8:80212966..80212985 60.67 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000249495 Chr8:80247995..80248351 CTGCTTCCGAGGAGCTCTAA Chr8:80247996..80248015 59.85 55
upstream ENSMUSE00000249488 Chr8:80243927..80244401 GAGGCGTAATGGCTGACAAT Chr8:80244281..80244300 60.1 50
upstream ENSMUSE00000249482 Chr8:80212968..80213095 GCATCACCGTCTTGAACCTC Chr8:80212988..80213007 60.67 55

*** Putative Vector Insertion (Chr 8: 80212967 - 80244402) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000211161 Chr8:80198812..80199010 GTACCATGACGAAGCCGATT Chr8:80198855..80198874 59.96 50
downstream ENSMUSE00000249472 Chr8:80195416..80195568 AGCCACCAGTCCTTCACATC Chr8:80195518..80195537 60.12 55
downstream ENSMUSE00000211162 Chr8:80191698..80191831 AGCAGTTCACACCGGTTCTT Chr8:80191679..80191698 59.77 50
downstream ENSMUSE00000211164 Chr8:80191222..80191330 GCCAGGTTAATGCCGATGTA Chr8:80191270..80191289 60.86 50
downstream ENSMUSE00000401911 Chr8:80186928..80189015 CATCTGTGGCGTAATGGTTG Chr8:80188784..80188803 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAAGAAAGGCGTGAGACCA Chr8:80238374..80238394 59.85 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGACATTACGGCCTGAGA Chr8:80238357..80238377 59.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031616