Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32135
Trapped Gene
Cgnl1 (ENSMUSG00000032232)
Vector Insertion
Chr 9: 71572284 - 71619368
Public Clones IST14168C9 (tigm) IST14687A1 (tigm) IST10918A2 (tigm) IST11015C9 (tigm)
IST14139F1 (tigm) IST14772D10 (tigm) IST10462D2 (tigm) IST14209G12 (tigm)
IST14413C1 (tigm) IST14297D4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000711561 (Chr9:71618839..71619367 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGACGAGTCGGACAGTTGGT Chr9:71619096..71619115 59.76 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000711561 (Chr9:71618839..71619367 -)
Downstram Exon
ENSMUSE00000217972 (Chr9:71572285..71573889 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGACGAGTCGGACAGTTGGT Chr9:71619096..71619115 59.76 55 GTGATGCTTCTTTGCGTTCA Chr9:71573346..71573365 59.99 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000418515 Chr9:71619316..71619409 No primer for this exon
upstream ENSMUSE00000711561 Chr9:71618839..71619367 AGACGAGTCGGACAGTTGGT Chr9:71619096..71619115 59.76 55
upstream ENSMUSE00000217972 Chr9:71572285..71573889 TGAACGCAAAGAAGCATCAC Chr9:71573368..71573387 59.99 45
upstream ENSMUSE00000709060 Chr9:71572285..71573889 TGAACGCAAAGAAGCATCAC Chr9:71573368..71573387 59.99 45

*** Putative Vector Insertion (Chr 9: 71572284 - 71619368) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000635665 Chr9:71571341..71571435 CCTCGTTCGTTTGTTGTGTG Chr9:71571359..71571378 60.19 50
downstream ENSMUSE00000635662 Chr9:71569403..71569508 CTTTTGGTGGCATCCTCATT Chr9:71569457..71569476 59.93 45
downstream ENSMUSE00000635660 Chr9:71565203..71565304 CTGTTGCCTTCAGAGGGAGA Chr9:71565254..71565273 60.52 55
downstream ENSMUSE00000635658 Chr9:71564215..71564363 CTCGCTCCTCCTTGATGTTC Chr9:71564314..71564333 59.95 55
downstream ENSMUSE00000635655 Chr9:71563130..71563265 TCACGCTCCATCTTCACTTG Chr9:71563217..71563236 59.98 50
downstream ENSMUSE00000532099 Chr9:71552955..71553167 TCCTGTTCCTCTTTGGCAAT Chr9:71553087..71553106 59.67 45
downstream ENSMUSE00000635651 Chr9:71503853..71504059 TTCGGAGTGTCTCCTTTGCT Chr9:71503839..71503858 59.99 50
downstream ENSMUSE00000635648 Chr9:71503100..71503204 CCTCCAGCTGCTGTACTTCAC Chr9:71503161..71503181 60.07 57.14
downstream ENSMUSE00000635647 Chr9:71499041..71499193 CTCGATGGTCTTGTCCAGGT Chr9:71499034..71499053 60.11 55
downstream ENSMUSE00000635645 Chr9:71498029..71498199 TTATACTCGCCCAGCTGCTT Chr9:71498110..71498129 60 50
downstream ENSMUSE00000635644 Chr9:71493299..71493460 GCCTCCAGCTCATACTCCAG Chr9:71493326..71493345 59.97 60
downstream ENSMUSE00000635643 Chr9:71489166..71489255 AGCAAGTCAGCGTTGGTTCT Chr9:71489175..71489194 60.06 50
downstream ENSMUSE00000635642 Chr9:71480405..71480488 AGAAGCTCGCTCCTCATCTG Chr9:71480441..71480460 59.85 55
downstream ENSMUSE00000635641 Chr9:71479538..71479662 AGGTGGATAATCCGGCTCTT Chr9:71479609..71479628 59.92 50
downstream ENSMUSE00000635638 Chr9:71478669..71478777 CATCACCAGCTCCTTCACCT Chr9:71478692..71478711 60.26 55
downstream ENSMUSE00000217984 Chr9:71478283..71478446 CTTTCCAGTCGGTCGATCTC Chr9:71478354..71478373 59.8 55
downstream ENSMUSE00000710565 Chr9:71477018..71477199 CTCAGTGGGGCTTCGTAGAG Chr9:71477088..71477107 60.01 60
downstream ENSMUSE00000338221 Chr9:71474316..71477199 CTCAGTGGGGCTTCGTAGAG Chr9:71477088..71477107 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCAGCACTTCCTGTGGTC Chr9:71598343..71598363 59.87 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCAGCACTTCCTGTGGTC Chr9:71598343..71598363 59.87 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032232