Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32138
Trapped Gene
Ttn (ENSMUSG00000051747)
Vector Insertion
Chr 2: 76646047 - 76646717
Public Clones IST10946F12 (tigm) IST11691D8 (tigm) IST14939E12 (tigm) IST10333F2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000689246 (Chr2:76646577..76646716 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000689246 (Chr2:76646577..76646716 -)
Downstram Exon
ENSMUSE00000601454 (Chr2:76646048..76646174 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000418798 Chr2:76820395..76820604 No primer for this exon
upstream ENSMUSE00000689428 Chr2:76820395..76820512 No primer for this exon
upstream ENSMUSE00000405588 Chr2:76818149..76818252 No primer for this exon
upstream ENSMUSE00000708711 Chr2:76818149..76818252 No primer for this exon
upstream ENSMUSE00000327638 Chr2:76815150..76815353 No primer for this exon
upstream ENSMUSE00000327633 Chr2:76812968..76813255 No primer for this exon
upstream ENSMUSE00000327110 Chr2:76812408..76812493 No primer for this exon
upstream ENSMUSE00000327101 Chr2:76812073..76812314 No primer for this exon
upstream ENSMUSE00000327095 Chr2:76807678..76808008 No primer for this exon
upstream ENSMUSE00000342745 Chr2:76807197..76807349 No primer for this exon
upstream ENSMUSE00000327729 Chr2:76806453..76806590 No primer for this exon
upstream ENSMUSE00000327721 Chr2:76805111..76805242 No primer for this exon
upstream ENSMUSE00000327714 Chr2:76803834..76803971 No primer for this exon
upstream ENSMUSE00000327799 Chr2:76803148..76803285 No primer for this exon
upstream ENSMUSE00000689759 Chr2:76802532..76802669 No primer for this exon
upstream ENSMUSE00000689758 Chr2:76792852..76793145 No primer for this exon
upstream ENSMUSE00000689757 Chr2:76792643..76792765 No primer for this exon
upstream ENSMUSE00000689756 Chr2:76791058..76791345 No primer for this exon
upstream ENSMUSE00000689755 Chr2:76790827..76790892 No primer for this exon
upstream ENSMUSE00000689754 Chr2:76789977..76790235 No primer for this exon
upstream ENSMUSE00000689753 Chr2:76789704..76789764 No primer for this exon
upstream ENSMUSE00000689751 Chr2:76789372..76789587 No primer for this exon
upstream ENSMUSE00000689748 Chr2:76788072..76788214 No primer for this exon
upstream ENSMUSE00000689747 Chr2:76786995..76787200 No primer for this exon
upstream ENSMUSE00000689746 Chr2:76786244..76786477 No primer for this exon
upstream ENSMUSE00000689745 Chr2:76785885..76786129 No primer for this exon
upstream ENSMUSE00000689742 Chr2:76784754..76785037 No primer for this exon
upstream ENSMUSE00000689741 Chr2:76784449..76784613 No primer for this exon
upstream ENSMUSE00000689740 Chr2:76784174..76784342 No primer for this exon
upstream ENSMUSE00000689739 Chr2:76782366..76784059 No primer for this exon
upstream ENSMUSE00000689738 Chr2:76781948..76782229 No primer for this exon
upstream ENSMUSE00000689737 Chr2:76781258..76781524 No primer for this exon
upstream ENSMUSE00000689736 Chr2:76780904..76781176 No primer for this exon
upstream ENSMUSE00000689735 Chr2:76780233..76780496 No primer for this exon
upstream ENSMUSE00000689734 Chr2:76779879..76780139 No primer for this exon
upstream ENSMUSE00000689732 Chr2:76777907..76778167 No primer for this exon
upstream ENSMUSE00000689731 Chr2:76777101..76777364 No primer for this exon
upstream ENSMUSE00000689730 Chr2:76776751..76777011 No primer for this exon
upstream ENSMUSE00000689729 Chr2:76776364..76776624 No primer for this exon
upstream ENSMUSE00000689728 Chr2:76775630..76775890 No primer for this exon
upstream ENSMUSE00000689727 Chr2:76774692..76774833 No primer for this exon
upstream ENSMUSE00000689726 Chr2:76774439..76774604 No primer for this exon
upstream ENSMUSE00000689725 Chr2:76772196..76772427 No primer for this exon
upstream ENSMUSE00000689724 Chr2:76770503..76770787 No primer for this exon
upstream ENSMUSE00000689266 Chr2:76770189..76770285 No primer for this exon
upstream ENSMUSE00000689723 Chr2:76770189..76770314 No primer for this exon
upstream ENSMUSE00000689722 Chr2:76765144..76765332 No primer for this exon
upstream ENSMUSE00000689720 Chr2:76759608..76759664 No primer for this exon
upstream ENSMUSE00000644291 Chr2:76752234..76758520 No primer for this exon
upstream ENSMUSE00000689427 Chr2:76745365..76748010 No primer for this exon
upstream ENSMUSE00000689719 Chr2:76744311..76744589 No primer for this exon
upstream ENSMUSE00000689718 Chr2:76741120..76741683 No primer for this exon
upstream ENSMUSE00000689716 Chr2:76739898..76740179 No primer for this exon
upstream ENSMUSE00000689715 Chr2:76739521..76739799 No primer for this exon
upstream ENSMUSE00000689714 Chr2:76738814..76739092 No primer for this exon
upstream ENSMUSE00000689713 Chr2:76738439..76738717 No primer for this exon
upstream ENSMUSE00000689712 Chr2:76738037..76738324 No primer for this exon
upstream ENSMUSE00000689711 Chr2:76737648..76737926 No primer for this exon
upstream ENSMUSE00000689709 Chr2:76737265..76737546 No primer for this exon
upstream ENSMUSE00000689707 Chr2:76736895..76737173 No primer for this exon
upstream ENSMUSE00000689705 Chr2:76736502..76736780 No primer for this exon
upstream ENSMUSE00000689704 Chr2:76736120..76736398 No primer for this exon
upstream ENSMUSE00000689703 Chr2:76735572..76735859 No primer for this exon
upstream ENSMUSE00000689702 Chr2:76735179..76735457 No primer for this exon
upstream ENSMUSE00000689701 Chr2:76734756..76735037 No primer for this exon
upstream ENSMUSE00000689700 Chr2:76734377..76734655 No primer for this exon
upstream ENSMUSE00000689699 Chr2:76733981..76734259 No primer for this exon
upstream ENSMUSE00000689697 Chr2:76733590..76733868 No primer for this exon
upstream ENSMUSE00000689696 Chr2:76733199..76733486 No primer for this exon
upstream ENSMUSE00000689695 Chr2:76732717..76732959 No primer for this exon
upstream ENSMUSE00000689426 Chr2:76732681..76732959 No primer for this exon
upstream ENSMUSE00000689693 Chr2:76732199..76732480 No primer for this exon
upstream ENSMUSE00000689691 Chr2:76730956..76731234 No primer for this exon
upstream ENSMUSE00000689690 Chr2:76730561..76730842 No primer for this exon
upstream ENSMUSE00000689688 Chr2:76729369..76729647 No primer for this exon
upstream ENSMUSE00000689686 Chr2:76728964..76729251 No primer for this exon
upstream ENSMUSE00000689685 Chr2:76728522..76728800 No primer for this exon
upstream ENSMUSE00000689683 Chr2:76728151..76728429 No primer for this exon
upstream ENSMUSE00000689227 Chr2:76727766..76727982 No primer for this exon
upstream ENSMUSE00000689681 Chr2:76727766..76728044 No primer for this exon
upstream ENSMUSE00000689679 Chr2:76727361..76727648 No primer for this exon
upstream ENSMUSE00000689678 Chr2:76726943..76727230 No primer for this exon
upstream ENSMUSE00000689675 Chr2:76725863..76726144 No primer for this exon
upstream ENSMUSE00000689673 Chr2:76725164..76725442 No primer for this exon
upstream ENSMUSE00000689672 Chr2:76724782..76725063 No primer for this exon
upstream ENSMUSE00000689671 Chr2:76724365..76724643 No primer for this exon
upstream ENSMUSE00000689669 Chr2:76723985..76724272 No primer for this exon
upstream ENSMUSE00000689668 Chr2:76723554..76723832 No primer for this exon
upstream ENSMUSE00000689667 Chr2:76723182..76723460 No primer for this exon
upstream ENSMUSE00000689666 Chr2:76722809..76723087 No primer for this exon
upstream ENSMUSE00000689665 Chr2:76722403..76722690 No primer for this exon
upstream ENSMUSE00000689664 Chr2:76721967..76722254 No primer for this exon
upstream ENSMUSE00000689663 Chr2:76719615..76719896 No primer for this exon
upstream ENSMUSE00000689660 Chr2:76719121..76719399 No primer for this exon
upstream ENSMUSE00000689659 Chr2:76718432..76718713 No primer for this exon
upstream ENSMUSE00000689657 Chr2:76718040..76718318 No primer for this exon
upstream ENSMUSE00000689656 Chr2:76717115..76717402 No primer for this exon
upstream ENSMUSE00000689655 Chr2:76716731..76717009 No primer for this exon
upstream ENSMUSE00000689654 Chr2:76716325..76716603 No primer for this exon
upstream ENSMUSE00000689653 Chr2:76715960..76716238 No primer for this exon
upstream ENSMUSE00000689652 Chr2:76714939..76715226 No primer for this exon
upstream ENSMUSE00000689651 Chr2:76714509..76714796 No primer for this exon
upstream ENSMUSE00000689650 Chr2:76713748..76714038 No primer for this exon
upstream ENSMUSE00000689649 Chr2:76711768..76712055 No primer for this exon
upstream ENSMUSE00000689648 Chr2:76711124..76711216 No primer for this exon
upstream ENSMUSE00000689647 Chr2:76710738..76711023 No primer for this exon
upstream ENSMUSE00000689646 Chr2:76709762..76709945 No primer for this exon
upstream ENSMUSE00000689645 Chr2:76709133..76709222 No primer for this exon
upstream ENSMUSE00000689644 Chr2:76708767..76709034 No primer for this exon
upstream ENSMUSE00000689216 Chr2:76708408..76708668 No primer for this exon
upstream ENSMUSE00000689643 Chr2:76708408..76708668 No primer for this exon
upstream ENSMUSE00000689642 Chr2:76706344..76706553 No primer for this exon
upstream ENSMUSE00000689641 Chr2:76706065..76706142 No primer for this exon
upstream ENSMUSE00000689640 Chr2:76705940..76705966 No primer for this exon
upstream ENSMUSE00000689639 Chr2:76705479..76705538 No primer for this exon
upstream ENSMUSE00000689638 Chr2:76705215..76705298 No primer for this exon
upstream ENSMUSE00000689637 Chr2:76703280..76703354 No primer for this exon
upstream ENSMUSE00000689425 Chr2:76702329..76702373 No primer for this exon
upstream ENSMUSE00000689636 Chr2:76702329..76702382 No primer for this exon
upstream ENSMUSE00000689635 Chr2:76701331..76701732 No primer for this exon
upstream ENSMUSE00000689634 Chr2:76700857..76700916 No primer for this exon
upstream ENSMUSE00000689633 Chr2:76700407..76700484 No primer for this exon
upstream ENSMUSE00000689632 Chr2:76700169..76700246 No primer for this exon
upstream ENSMUSE00000689631 Chr2:76699480..76699566 No primer for this exon
upstream ENSMUSE00000689630 Chr2:76699154..76699234 No primer for this exon
upstream ENSMUSE00000689225 Chr2:76697972..76698054 No primer for this exon
upstream ENSMUSE00000689629 Chr2:76697971..76698054 No primer for this exon
upstream ENSMUSE00000689628 Chr2:76697517..76697603 No primer for this exon
upstream ENSMUSE00000689627 Chr2:76695961..76696044 No primer for this exon
upstream ENSMUSE00000689626 Chr2:76695667..76695747 No primer for this exon
upstream ENSMUSE00000689625 Chr2:76695454..76695531 No primer for this exon
upstream ENSMUSE00000689624 Chr2:76695212..76695286 No primer for this exon
upstream ENSMUSE00000689623 Chr2:76694860..76694961 No primer for this exon
upstream ENSMUSE00000689622 Chr2:76694322..76694423 No primer for this exon
upstream ENSMUSE00000689621 Chr2:76692444..76692524 No primer for this exon
upstream ENSMUSE00000689620 Chr2:76692207..76692275 No primer for this exon
upstream ENSMUSE00000689619 Chr2:76691908..76691985 No primer for this exon
upstream ENSMUSE00000689618 Chr2:76691662..76691745 No primer for this exon
upstream ENSMUSE00000689617 Chr2:76691212..76691295 No primer for this exon
upstream ENSMUSE00000689616 Chr2:76690891..76690974 No primer for this exon
upstream ENSMUSE00000689615 Chr2:76690114..76690194 No primer for this exon
upstream ENSMUSE00000689613 Chr2:76689612..76689821 No primer for this exon
upstream ENSMUSE00000689612 Chr2:76688627..76688701 No primer for this exon
upstream ENSMUSE00000689610 Chr2:76688363..76688437 No primer for this exon
upstream ENSMUSE00000689609 Chr2:76688052..76688144 No primer for this exon
upstream ENSMUSE00000689608 Chr2:76687314..76687391 No primer for this exon
upstream ENSMUSE00000689424 Chr2:76686874..76687128 No primer for this exon
upstream ENSMUSE00000689607 Chr2:76686874..76687227 No primer for this exon
upstream ENSMUSE00000689606 Chr2:76686616..76686699 No primer for this exon
upstream ENSMUSE00000689288 Chr2:76686336..76686417 No primer for this exon
upstream ENSMUSE00000689605 Chr2:76686336..76686413 No primer for this exon
upstream ENSMUSE00000689224 Chr2:76685782..76685866 No primer for this exon
upstream ENSMUSE00000689604 Chr2:76685782..76685865 No primer for this exon
upstream ENSMUSE00000689602 Chr2:76685445..76685528 No primer for this exon
upstream ENSMUSE00000689601 Chr2:76685170..76685253 No primer for this exon
upstream ENSMUSE00000689600 Chr2:76684683..76684973 No primer for this exon
upstream ENSMUSE00000689423 Chr2:76684293..76684370 No primer for this exon
upstream ENSMUSE00000689599 Chr2:76683079..76683153 No primer for this exon
upstream ENSMUSE00000689598 Chr2:76682262..76682336 No primer for this exon
upstream ENSMUSE00000689597 Chr2:76681433..76681549 No primer for this exon
upstream ENSMUSE00000689596 Chr2:76680828..76680905 No primer for this exon
upstream ENSMUSE00000689593 Chr2:76679825..76679893 No primer for this exon
upstream ENSMUSE00000689422 Chr2:76679591..76679662 No primer for this exon
upstream ENSMUSE00000689590 Chr2:76679591..76679683 No primer for this exon
upstream ENSMUSE00000644320 Chr2:76679147..76679212 No primer for this exon
upstream ENSMUSE00000689587 Chr2:76679147..76679446 No primer for this exon
upstream ENSMUSE00000644319 Chr2:76678290..76678370 No primer for this exon
upstream ENSMUSE00000689212 Chr2:76678290..76678370 No primer for this exon
upstream ENSMUSE00000689579 Chr2:76677462..76677539 No primer for this exon
upstream ENSMUSE00000689421 Chr2:76676869..76676952 No primer for this exon
upstream ENSMUSE00000689420 Chr2:76676626..76676700 No primer for this exon
upstream ENSMUSE00000644295 Chr2:76674790..76674870 No primer for this exon
upstream ENSMUSE00000644294 Chr2:76674596..76674679 No primer for this exon
upstream ENSMUSE00000644293 Chr2:76674392..76674475 No primer for this exon
upstream ENSMUSE00000644292 Chr2:76673994..76674071 No primer for this exon
upstream ENSMUSE00000689419 Chr2:76672870..76672953 No primer for this exon
upstream ENSMUSE00000689418 Chr2:76671892..76671978 No primer for this exon
upstream ENSMUSE00000689417 Chr2:76671698..76671775 No primer for this exon
upstream ENSMUSE00000689416 Chr2:76671280..76671363 No primer for this exon
upstream ENSMUSE00000689415 Chr2:76671087..76671170 No primer for this exon
upstream ENSMUSE00000689414 Chr2:76670907..76670990 No primer for this exon
upstream ENSMUSE00000689413 Chr2:76670713..76670796 No primer for this exon
upstream ENSMUSE00000689575 Chr2:76670713..76670778 No primer for this exon
upstream ENSMUSE00000689574 Chr2:76670520..76670603 No primer for this exon
upstream ENSMUSE00000689412 Chr2:76670325..76670408 No primer for this exon
upstream ENSMUSE00000644317 Chr2:76670158..76670241 No primer for this exon
upstream ENSMUSE00000689211 Chr2:76670158..76670241 No primer for this exon
upstream ENSMUSE00000644316 Chr2:76669845..76669931 No primer for this exon
upstream ENSMUSE00000689210 Chr2:76669845..76669931 No primer for this exon
upstream ENSMUSE00000689411 Chr2:76669417..76669500 No primer for this exon
upstream ENSMUSE00000689410 Chr2:76669224..76669304 No primer for this exon
upstream ENSMUSE00000689409 Chr2:76669033..76669113 No primer for this exon
upstream ENSMUSE00000689408 Chr2:76668841..76668906 No primer for this exon
upstream ENSMUSE00000689407 Chr2:76668649..76668729 No primer for this exon
upstream ENSMUSE00000689406 Chr2:76668466..76668537 No primer for this exon
upstream ENSMUSE00000689405 Chr2:76668273..76668353 No primer for this exon
upstream ENSMUSE00000689404 Chr2:76668082..76668162 No primer for this exon
upstream ENSMUSE00000689403 Chr2:76667901..76667966 No primer for this exon
upstream ENSMUSE00000689402 Chr2:76667711..76667794 No primer for this exon
upstream ENSMUSE00000689401 Chr2:76667304..76667387 No primer for this exon
upstream ENSMUSE00000689400 Chr2:76667124..76667207 No primer for this exon
upstream ENSMUSE00000689573 Chr2:76666930..76667013 No primer for this exon
upstream ENSMUSE00000689571 Chr2:76666737..76666820 No primer for this exon
upstream ENSMUSE00000689399 Chr2:76666543..76666626 No primer for this exon
upstream ENSMUSE00000689568 Chr2:76666376..76666459 No primer for this exon
upstream ENSMUSE00000689565 Chr2:76666158..76666244 No primer for this exon
upstream ENSMUSE00000689562 Chr2:76665942..76666025 No primer for this exon
upstream ENSMUSE00000689559 Chr2:76665749..76665823 No primer for this exon
upstream ENSMUSE00000689556 Chr2:76665540..76665617 No primer for this exon
upstream ENSMUSE00000644315 Chr2:76665052..76665135 No primer for this exon
upstream ENSMUSE00000689209 Chr2:76665052..76665135 No primer for this exon
upstream ENSMUSE00000644314 Chr2:76664504..76664599 No primer for this exon
upstream ENSMUSE00000689206 Chr2:76664504..76664599 No primer for this exon
upstream ENSMUSE00000644313 Chr2:76664132..76664209 No primer for this exon
upstream ENSMUSE00000689398 Chr2:76663856..76663933 No primer for this exon
upstream ENSMUSE00000689397 Chr2:76663564..76663647 No primer for this exon
upstream ENSMUSE00000689396 Chr2:76662282..76662365 No primer for this exon
upstream ENSMUSE00000689395 Chr2:76661989..76662069 No primer for this exon
upstream ENSMUSE00000689394 Chr2:76660955..76661029 No primer for this exon
upstream ENSMUSE00000644312 Chr2:76660508..76660621 No primer for this exon
upstream ENSMUSE00000710818 Chr2:76659173..76659241 No primer for this exon
upstream ENSMUSE00000722266 Chr2:76659173..76659241 No primer for this exon
upstream ENSMUSE00000644310 Chr2:76656793..76656873 No primer for this exon
upstream ENSMUSE00000689205 Chr2:76656793..76656873 No primer for this exon
upstream ENSMUSE00000644309 Chr2:76655846..76655920 No primer for this exon
upstream ENSMUSE00000689204 Chr2:76655846..76655920 No primer for this exon
upstream ENSMUSE00000644308 Chr2:76655046..76655132 No primer for this exon
upstream ENSMUSE00000689202 Chr2:76655046..76655132 No primer for this exon
upstream ENSMUSE00000644307 Chr2:76654600..76654662 No primer for this exon
upstream ENSMUSE00000689200 Chr2:76654600..76654662 No primer for this exon
upstream ENSMUSE00000644305 Chr2:76654216..76654305 No primer for this exon
upstream ENSMUSE00000689199 Chr2:76654216..76654305 No primer for this exon
upstream ENSMUSE00000644304 Chr2:76653585..76653632 No primer for this exon
upstream ENSMUSE00000689198 Chr2:76653585..76653632 No primer for this exon
upstream ENSMUSE00000689214 Chr2:76652834..76652976 No primer for this exon
upstream ENSMUSE00000689215 Chr2:76652816..76652976 No primer for this exon
upstream ENSMUSE00000644336 Chr2:76652575..76652976 No primer for this exon
upstream ENSMUSE00000709438 Chr2:76652575..76652976 No primer for this exon
upstream ENSMUSE00000720807 Chr2:76652575..76652976 No primer for this exon
upstream ENSMUSE00000689221 Chr2:76652195..76652473 No primer for this exon
upstream ENSMUSE00000709899 Chr2:76652195..76652473 No primer for this exon
upstream ENSMUSE00000709908 Chr2:76652195..76652473 No primer for this exon
upstream ENSMUSE00000601466 Chr2:76651393..76651668 No primer for this exon
upstream ENSMUSE00000689263 Chr2:76651393..76651668 No primer for this exon
upstream ENSMUSE00000601465 Chr2:76650944..76651083 No primer for this exon
upstream ENSMUSE00000689262 Chr2:76650944..76651083 No primer for this exon
upstream ENSMUSE00000601464 Chr2:76650534..76650660 No primer for this exon
upstream ENSMUSE00000689261 Chr2:76650534..76650660 No primer for this exon
upstream ENSMUSE00000601463 Chr2:76650169..76650432 No primer for this exon
upstream ENSMUSE00000689260 Chr2:76650169..76650432 No primer for this exon
upstream ENSMUSE00000601462 Chr2:76649580..76649846 No primer for this exon
upstream ENSMUSE00000689259 Chr2:76649580..76649846 No primer for this exon
upstream ENSMUSE00000601461 Chr2:76649199..76649462 No primer for this exon
upstream ENSMUSE00000689258 Chr2:76649199..76649462 No primer for this exon
upstream ENSMUSE00000601460 Chr2:76648969..76649108 No primer for this exon
upstream ENSMUSE00000689254 Chr2:76648969..76649108 No primer for this exon
upstream ENSMUSE00000601459 Chr2:76648705..76648831 No primer for this exon
upstream ENSMUSE00000689253 Chr2:76648705..76648831 No primer for this exon
upstream ENSMUSE00000601458 Chr2:76648317..76648583 No primer for this exon
upstream ENSMUSE00000689252 Chr2:76648317..76648583 No primer for this exon
upstream ENSMUSE00000601457 Chr2:76647910..76648176 No primer for this exon
upstream ENSMUSE00000689250 Chr2:76647910..76648176 No primer for this exon
upstream ENSMUSE00000601456 Chr2:76646808..76647074 No primer for this exon
upstream ENSMUSE00000689248 Chr2:76646808..76647074 No primer for this exon
upstream ENSMUSE00000601455 Chr2:76646577..76646716 No primer for this exon
upstream ENSMUSE00000689246 Chr2:76646577..76646716 No primer for this exon
upstream ENSMUSE00000601454 Chr2:76646048..76646174 No primer for this exon
upstream ENSMUSE00000689242 Chr2:76646048..76646174 No primer for this exon

*** Putative Vector Insertion (Chr 2: 76646047 - 76646717) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000601453 Chr2:76645118..76645260 No primer for this exon
downstream ENSMUSE00000644302 Chr2:76645118..76645260 No primer for this exon
downstream ENSMUSE00000644300 Chr2:76641350..76641473 No primer for this exon
downstream ENSMUSE00000689240 Chr2:76641350..76641473 No primer for this exon
downstream ENSMUSE00000601452 Chr2:76640288..76640554 No primer for this exon
downstream ENSMUSE00000644298 Chr2:76640288..76640554 No primer for this exon
downstream ENSMUSE00000644296 Chr2:76638594..76638637 No primer for this exon
downstream ENSMUSE00000689482 Chr2:76638540..76638637 No primer for this exon
downstream ENSMUSE00000601450 Chr2:76637497..76637665 No primer for this exon
downstream ENSMUSE00000601449 Chr2:76637141..76637407 No primer for this exon
downstream ENSMUSE00000601448 Chr2:76636771..76637037 No primer for this exon
downstream ENSMUSE00000601447 Chr2:76636408..76636686 No primer for this exon
downstream ENSMUSE00000601446 Chr2:76635905..76636313 No primer for this exon
downstream ENSMUSE00000601445 Chr2:76635670..76635794 No primer for this exon
downstream ENSMUSE00000601444 Chr2:76635296..76635562 No primer for this exon
downstream ENSMUSE00000601443 Chr2:76634327..76634596 No primer for this exon
downstream ENSMUSE00000601442 Chr2:76633935..76634237 No primer for this exon
downstream ENSMUSE00000601441 Chr2:76633536..76633838 No primer for this exon
downstream ENSMUSE00000601440 Chr2:76633112..76633299 No primer for this exon
downstream ENSMUSE00000601439 Chr2:76632856..76632970 No primer for this exon
downstream ENSMUSE00000601438 Chr2:76632467..76632751 No primer for this exon
downstream ENSMUSE00000601437 Chr2:76632209..76632360 No primer for this exon
downstream ENSMUSE00000601436 Chr2:76631166..76631313 No primer for this exon
downstream ENSMUSE00000601435 Chr2:76630848..76631025 No primer for this exon
downstream ENSMUSE00000601434 Chr2:76629921..76630042 No primer for this exon
downstream ENSMUSE00000601433 Chr2:76629543..76629830 No primer for this exon
downstream ENSMUSE00000601432 Chr2:76629144..76629440 No primer for this exon
downstream ENSMUSE00000601431 Chr2:76628853..76629039 No primer for this exon
downstream ENSMUSE00000601430 Chr2:76628326..76628441 No primer for this exon
downstream ENSMUSE00000601429 Chr2:76627936..76628235 No primer for this exon
downstream ENSMUSE00000601428 Chr2:76627469..76627768 No primer for this exon
downstream ENSMUSE00000601427 Chr2:76627271..76627376 No primer for this exon
downstream ENSMUSE00000601426 Chr2:76626960..76627156 No primer for this exon
downstream ENSMUSE00000601425 Chr2:76626571..76626876 No primer for this exon
downstream ENSMUSE00000601424 Chr2:76626197..76626475 No primer for this exon
downstream ENSMUSE00000601423 Chr2:76625084..76625383 No primer for this exon
downstream ENSMUSE00000601422 Chr2:76624674..76624976 No primer for this exon
downstream ENSMUSE00000601421 Chr2:76624200..76624562 No primer for this exon
downstream ENSMUSE00000601420 Chr2:76623587..76623889 No primer for this exon
downstream ENSMUSE00000601419 Chr2:76623159..76623458 No primer for this exon
downstream ENSMUSE00000601418 Chr2:76622765..76623061 No primer for this exon
downstream ENSMUSE00000601417 Chr2:76622378..76622662 No primer for this exon
downstream ENSMUSE00000689318 Chr2:76622378..76622665 No primer for this exon
downstream ENSMUSE00000601416 Chr2:76621981..76622274 No primer for this exon
downstream ENSMUSE00000601415 Chr2:76620247..76620546 No primer for this exon
downstream ENSMUSE00000601414 Chr2:76619846..76620154 No primer for this exon
downstream ENSMUSE00000601413 Chr2:76619570..76619760 No primer for this exon
downstream ENSMUSE00000601412 Chr2:76618770..76619199 No primer for this exon
downstream ENSMUSE00000601411 Chr2:76617335..76617643 No primer for this exon
downstream ENSMUSE00000601410 Chr2:76617063..76617211 No primer for this exon
downstream ENSMUSE00000601409 Chr2:76616946..76616978 No primer for this exon
downstream ENSMUSE00000601408 Chr2:76616722..76616851 No primer for this exon
downstream ENSMUSE00000601407 Chr2:76616333..76616632 No primer for this exon
downstream ENSMUSE00000601406 Chr2:76615922..76616239 No primer for this exon
downstream ENSMUSE00000601405 Chr2:76614725..76615021 No primer for this exon
downstream ENSMUSE00000601404 Chr2:76614312..76614611 No primer for this exon
downstream ENSMUSE00000601403 Chr2:76613896..76614210 No primer for this exon
downstream ENSMUSE00000601402 Chr2:76613648..76613796 No primer for this exon
downstream ENSMUSE00000601401 Chr2:76612811..76612961 No primer for this exon
downstream ENSMUSE00000601400 Chr2:76612439..76612720 No primer for this exon
downstream ENSMUSE00000601399 Chr2:76610424..76610726 No primer for this exon
downstream ENSMUSE00000601398 Chr2:76609561..76609863 No primer for this exon
downstream ENSMUSE00000601397 Chr2:76609181..76609462 No primer for this exon
downstream ENSMUSE00000601396 Chr2:76608790..76609089 No primer for this exon
downstream ENSMUSE00000601395 Chr2:76608396..76608698 No primer for this exon
downstream ENSMUSE00000601394 Chr2:76607995..76608303 No primer for this exon
downstream ENSMUSE00000601393 Chr2:76607597..76607878 No primer for this exon
downstream ENSMUSE00000601392 Chr2:76607214..76607513 No primer for this exon
downstream ENSMUSE00000601391 Chr2:76606838..76607131 No primer for this exon
downstream ENSMUSE00000601390 Chr2:76603775..76606741 No primer for this exon
downstream ENSMUSE00000601389 Chr2:76602691..76603011 No primer for this exon
downstream ENSMUSE00000601388 Chr2:76602302..76602586 No primer for this exon
downstream ENSMUSE00000601387 Chr2:76601904..76602203 No primer for this exon
downstream ENSMUSE00000601386 Chr2:76601293..76601595 No primer for this exon
downstream ENSMUSE00000601385 Chr2:76600627..76600902 No primer for this exon
downstream ENSMUSE00000601384 Chr2:76600209..76600508 No primer for this exon
downstream ENSMUSE00000601383 Chr2:76599711..76600013 No primer for this exon
downstream ENSMUSE00000601382 Chr2:76599143..76599442 No primer for this exon
downstream ENSMUSE00000601381 Chr2:76597895..76598182 No primer for this exon
downstream ENSMUSE00000601380 Chr2:76597143..76597439 No primer for this exon
downstream ENSMUSE00000601379 Chr2:76596749..76597051 No primer for this exon
downstream ENSMUSE00000601378 Chr2:76596349..76596654 No primer for this exon
downstream ENSMUSE00000601377 Chr2:76595085..76595372 No primer for this exon
downstream ENSMUSE00000601376 Chr2:76594698..76594988 No primer for this exon
downstream ENSMUSE00000601375 Chr2:76594324..76594611 No primer for this exon
downstream ENSMUSE00000601374 Chr2:76593556..76594143 No primer for this exon
downstream ENSMUSE00000601373 Chr2:76593356..76593460 No primer for this exon
downstream ENSMUSE00000601372 Chr2:76592815..76593012 No primer for this exon
downstream ENSMUSE00000601371 Chr2:76592423..76592719 No primer for this exon
downstream ENSMUSE00000601370 Chr2:76591745..76592332 No primer for this exon
downstream ENSMUSE00000601369 Chr2:76591341..76591643 No primer for this exon
downstream ENSMUSE00000601368 Chr2:76574121..76591226 No primer for this exon
downstream ENSMUSE00000601367 Chr2:76573283..76573579 No primer for this exon
downstream ENSMUSE00000601366 Chr2:76572570..76573157 No primer for this exon
downstream ENSMUSE00000601365 Chr2:76572177..76572479 No primer for this exon
downstream ENSMUSE00000601364 Chr2:76571775..76572071 No primer for this exon
downstream ENSMUSE00000601363 Chr2:76570409..76570696 No primer for this exon
downstream ENSMUSE00000601362 Chr2:76570000..76570299 No primer for this exon
downstream ENSMUSE00000601361 Chr2:76569452..76569754 No primer for this exon
downstream ENSMUSE00000601360 Chr2:76569052..76569357 No primer for this exon
downstream ENSMUSE00000601359 Chr2:76567180..76568946 No primer for this exon
downstream ENSMUSE00000601358 Chr2:76566366..76566659 No primer for this exon
downstream ENSMUSE00000601357 Chr2:76565403..76565690 No primer for this exon
downstream ENSMUSE00000601356 Chr2:76564991..76565290 No primer for this exon
downstream ENSMUSE00000601355 Chr2:76562835..76564901 No primer for this exon
downstream ENSMUSE00000601354 Chr2:76562431..76562733 No primer for this exon
downstream ENSMUSE00000601353 Chr2:76562036..76562341 No primer for this exon
downstream ENSMUSE00000601352 Chr2:76561633..76561923 No primer for this exon
downstream ENSMUSE00000601351 Chr2:76561250..76561546 No primer for this exon
downstream ENSMUSE00000601350 Chr2:76560816..76561121 No primer for this exon
downstream ENSMUSE00000601349 Chr2:76559658..76559963 No primer for this exon
downstream ENSMUSE00000601348 Chr2:76559291..76559572 No primer for this exon
downstream ENSMUSE00000601347 Chr2:76558537..76559130 No primer for this exon
downstream ENSMUSE00000601346 Chr2:76558139..76558426 No primer for this exon
downstream ENSMUSE00000601345 Chr2:76557738..76558037 No primer for this exon
downstream ENSMUSE00000420861 Chr2:76556931..76557233 No primer for this exon
downstream ENSMUSE00000420262 Chr2:76556352..76556654 No primer for this exon
downstream ENSMUSE00000420255 Chr2:76555668..76556252 No primer for this exon
downstream ENSMUSE00000420248 Chr2:76555230..76555535 No primer for this exon
downstream ENSMUSE00000420245 Chr2:76554806..76555105 No primer for this exon
downstream ENSMUSE00000712317 Chr2:76553597..76554172 No primer for this exon
downstream ENSMUSE00000721335 Chr2:76553597..76554172 No primer for this exon
downstream ENSMUSE00000420237 Chr2:76553201..76553506 No primer for this exon
downstream ENSMUSE00000689445 Chr2:76553201..76553506 No primer for this exon
downstream ENSMUSE00000420233 Chr2:76552386..76552979 No primer for this exon
downstream ENSMUSE00000689444 Chr2:76552386..76552979 No primer for this exon
downstream ENSMUSE00000420268 Chr2:76551689..76552269 No primer for this exon
downstream ENSMUSE00000689393 Chr2:76546833..76552269 No primer for this exon
downstream ENSMUSE00000689317 Chr2:76546811..76552269 No primer for this exon
downstream ENSMUSE00000689443 Chr2:76546811..76552269 No primer for this exon
downstream ENSMUSE00000420897 Chr2:76546505..76546624 No primer for this exon
downstream ENSMUSE00000689316 Chr2:76546505..76546654 No primer for this exon
downstream ENSMUSE00000689392 Chr2:76546505..76546676 No primer for this exon
downstream ENSMUSE00000689442 Chr2:76546505..76546654 No primer for this exon
downstream ENSMUSE00000420894 Chr2:76546216..76546372 No primer for this exon
downstream ENSMUSE00000689441 Chr2:76546216..76546372 No primer for this exon
downstream ENSMUSE00000372372 Chr2:76544754..76545445 No primer for this exon
downstream ENSMUSE00000718156 Chr2:76544754..76545445 No primer for this exon
downstream ENSMUSE00000720875 Chr2:76544754..76545445 No primer for this exon
downstream ENSMUSE00000165524 Chr2:76544497..76544650 No primer for this exon
downstream ENSMUSE00000689314 Chr2:76544497..76544650 No primer for this exon
downstream ENSMUSE00000165519 Chr2:76543727..76544029 No primer for this exon
downstream ENSMUSE00000689313 Chr2:76543727..76544029 No primer for this exon
downstream ENSMUSE00000472988 Chr2:76542077..76543386 No primer for this exon
downstream ENSMUSE00000566110 Chr2:76542041..76543386 No primer for this exon
downstream ENSMUSE00000689312 Chr2:76542041..76543386 No primer for this exon
downstream ENSMUSE00000689391 Chr2:76542037..76543386 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGGACGTGACTGGGAAAAC Chr2:76646651..76646671 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051747