Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32175
Trapped Gene
Rgl1 (ENSMUSG00000026482)
Vector Insertion
Chr 1: 154418727 - 154433746
Public Clones IST13123A9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000159631 (Chr1:154433537..154433745 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAGCTGGTACGCTGGAGAA Chr1:154433657..154433676 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000159631 (Chr1:154433537..154433745 -)
Downstram Exon
ENSMUSE00000159614 (Chr1:154418728..154418805 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAGCTGGTACGCTGGAGAA Chr1:154433657..154433676 60.01 50 CTTTGGCTTCCATCGTCTTC Chr1:154418736..154418755 59.81 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000689287 Chr1:154613037..154613481 AAGGACGGAATCGAAAAGGT Chr1:154613099..154613118 59.94 45
upstream ENSMUSE00000689329 Chr1:154613037..154613435 AAGGACGGAATCGAAAAGGT Chr1:154613099..154613118 59.94 45
upstream ENSMUSE00000689328 Chr1:154521990..154522153 CTTTCAAGATGGAGGGGACA Chr1:154522110..154522129 60.04 50
upstream ENSMUSE00000537803 Chr1:154472114..154472241 GTGCCGGAAAGAAAACTGAG Chr1:154472142..154472161 59.85 50
upstream ENSMUSE00000257784 Chr1:154470948..154471058 TTCAGGACTGGGGTGAAGAG Chr1:154471032..154471051 60.23 55
upstream ENSMUSE00000159631 Chr1:154433537..154433745 AAAGCTGGTACGCTGGAGAA Chr1:154433657..154433676 60.01 50
upstream ENSMUSE00000159614 Chr1:154418728..154418805 GCCCAAACTGTGAAGACGAT Chr1:154418769..154418788 60.12 50

*** Putative Vector Insertion (Chr 1: 154418727 - 154433746) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000159625 Chr1:154404533..154404717 GAAGTCTTCCGCACACTGGT Chr1:154404644..154404663 60.31 55
downstream ENSMUSE00000159618 Chr1:154401426..154401550 TGAAGGAGCTGGTGTTGAGA Chr1:154401502..154401521 59.54 50
downstream ENSMUSE00000159613 Chr1:154399551..154399766 TCCTTTTTATCCCGCTGAGA Chr1:154399677..154399696 59.78 45
downstream ENSMUSE00000159610 Chr1:154396197..154396300 TTAGACTGCAGTGCGGAAAC Chr1:154396217..154396236 59.08 50
downstream ENSMUSE00000257741 Chr1:154391481..154391565 TCCCGACTGGTTAGATGGTT Chr1:154391472..154391491 59.4 50
downstream ENSMUSE00000159609 Chr1:154387067..154387156 GGTCCGCTTCTGGTTTTCTT Chr1:154387075..154387094 60.61 50
downstream ENSMUSE00000257728 Chr1:154384861..154384947 ATGTAGTCCTGCAGGGCAGT Chr1:154384843..154384862 59.75 55
downstream ENSMUSE00000257724 Chr1:154383397..154383429 No primer for this exon
downstream ENSMUSE00000159623 Chr1:154380636..154380757 AGCTGTTGCAAGCAGACTGT Chr1:154380684..154380703 58.83 50
downstream ENSMUSE00000159617 Chr1:154378636..154378725 CATGCTTTTCCGAGGCTTAG Chr1:154378631..154378650 59.97 50
downstream ENSMUSE00000159624 Chr1:154375403..154375589 TGGTTTGATTCACAGGACGA Chr1:154375442..154375461 60.09 45
downstream ENSMUSE00000159615 Chr1:154371775..154372029 CCTGAGGAATTCGTGTCCAT Chr1:154371949..154371968 59.93 50
downstream ENSMUSE00000159626 Chr1:154368425..154368539 ACTCCAGGTTGTGCTTCGAC Chr1:154368454..154368473 60.31 55
downstream ENSMUSE00000689286 Chr1:154365610..154366326 TGCTGTGCCTGTTACTCCAG Chr1:154366131..154366150 60.05 55
downstream ENSMUSE00000379670 Chr1:154364660..154366326 CTTAGCTGTCCTGGGCAAAG Chr1:154366159..154366178 60.01 55
downstream ENSMUSE00000689289 Chr1:154363890..154366326 CTTAGCTGTCCTGGGCAAAG Chr1:154366159..154366178 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAGCCTGGTAATTGTTGG Chr1:154430771..154430791 60.88 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGACGTGACTGGGAAAACC Chr1:154430679..154430699 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026482