Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3218
Trapped Gene
Amotl1 (ENSMUSG00000013076)
Vector Insertion
Chr 9: 14360209 - 14362902
Public Clones AY0687 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000215748 (Chr9:14362903..14363052 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000215748 (Chr9:14362903..14363052 -)
Downstram Exon
ENSMUSE00000215747 (Chr9:14360018..14360208 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703706 Chr9:14419178..14419444 No primer for this exon
upstream ENSMUSE00000389841 Chr9:14400895..14401044 No primer for this exon
upstream ENSMUSE00000310699 Chr9:14397198..14398155 No primer for this exon
upstream ENSMUSE00000214694 Chr9:14379595..14379883 No primer for this exon
upstream ENSMUSE00000310664 Chr9:14377119..14377263 No primer for this exon
upstream ENSMUSE00000310642 Chr9:14376067..14376156 No primer for this exon
upstream ENSMUSE00000310615 Chr9:14366519..14366664 No primer for this exon
upstream ENSMUSE00000215748 Chr9:14362903..14363052 No primer for this exon

*** Putative Vector Insertion (Chr 9: 14360209 - 14362902) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000215747 Chr9:14360018..14360208 No primer for this exon
downstream ENSMUSE00000215745 Chr9:14356066..14356191 No primer for this exon
downstream ENSMUSE00000215744 Chr9:14354836..14355065 No primer for this exon
downstream ENSMUSE00000215743 Chr9:14352975..14353250 No primer for this exon
downstream ENSMUSE00000215749 Chr9:14346410..14352342 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGTGAGTGACAGGCTGAG Chr9:14362884..14362904 59.6 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGTGAGTGACAGGCTGAG Chr9:14362884..14362904 59.6 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013076