Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32182
Trapped Gene
Tcirg1 (ENSMUSG00000001750)
Vector Insertion
Chr 19: 3898979 - 3902036
Public Clones IST12317B12 (tigm) IST11186H2 (tigm) IST14142H2 (tigm) IST14846D6 (tigm)
IST10454H12 (tigm) IST14666C8 (tigm) IST11629G6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000145872 (Chr19:3901891..3902035 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000145872 (Chr19:3901891..3902035 -)
Downstram Exon
ENSMUSE00000145865 (Chr19:3898980..3899119 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000349478 Chr19:3907019..3907040 No primer for this exon
upstream ENSMUSE00000145849 Chr19:3904585..3904705 No primer for this exon
upstream ENSMUSE00000145840 Chr19:3904217..3904295 No primer for this exon
upstream ENSMUSE00000145877 Chr19:3903509..3903729 No primer for this exon
upstream ENSMUSE00000145879 Chr19:3903340..3903428 No primer for this exon
upstream ENSMUSE00000145868 Chr19:3903046..3903172 No primer for this exon
upstream ENSMUSE00000429593 Chr19:3902882..3902964 No primer for this exon
upstream ENSMUSE00000429587 Chr19:3902631..3902724 No primer for this exon
upstream ENSMUSE00000145853 Chr19:3902344..3902556 No primer for this exon
upstream ENSMUSE00000145872 Chr19:3901891..3902035 No primer for this exon
upstream ENSMUSE00000145865 Chr19:3898980..3899119 No primer for this exon

*** Putative Vector Insertion (Chr 19: 3898979 - 3902036) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000145831 Chr19:3898718..3898875 No primer for this exon
downstream ENSMUSE00000145847 Chr19:3898548..3898638 No primer for this exon
downstream ENSMUSE00000555103 Chr19:3897758..3897876 No primer for this exon
downstream ENSMUSE00000240142 Chr19:3897468..3897681 No primer for this exon
downstream ENSMUSE00000240125 Chr19:3897038..3897169 No primer for this exon
downstream ENSMUSE00000240115 Chr19:3896795..3896902 No primer for this exon
downstream ENSMUSE00000555091 Chr19:3896604..3896721 No primer for this exon
downstream ENSMUSE00000145834 Chr19:3896270..3896447 No primer for this exon
downstream ENSMUSE00000383962 Chr19:3896052..3896192 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACGGACTGCTCATGTTTCT Chr19:3899039..3899059 58.88 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACGGACTGCTCATGTTTCT Chr19:3899039..3899059 58.88 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001750