Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32208
Trapped Gene
Odz3 (ENSMUSG00000031561)
Vector Insertion
Chr 8: 49502361 - 49641048
Public Clones (sanger) (sanger) IST13878D12 (tigm) IST14311H4 (tigm) IST10852D12 (tigm)
IST14595G6 (tigm) IST14660H2 (tigm) IST10817C12 (tigm) IST14357A8 (tigm)
IST14513B3 (tigm) IST14409D5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000683611 (Chr8:49640507..49641047 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGTGAGTGTGTGTGTGTGT Chr8:49640924..49640943 59.2 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000683611 (Chr8:49640507..49641047 -)
Downstram Exon
ENSMUSE00000683616 (Chr8:49502362..49502603 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGTGAGTGTGTGTGTGTGT Chr8:49640924..49640943 59.2 55 GGGTTGTTTGAAGGTTGCTC Chr8:49502559..49502578 59.57 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683597 Chr8:49929132..49929268 GAGCGGAGGAGTCAAGGATT Chr8:49929205..49929224 60.74 55
upstream ENSMUSE00000473700 Chr8:49759764..49760044 ATGATTCTTCACGGCTGCTT Chr8:49759822..49759841 59.84 45
upstream ENSMUSE00000683596 Chr8:49759570..49760076 ATGATTCTTCACGGCTGCTT Chr8:49759822..49759841 59.84 45
upstream ENSMUSE00000494413 Chr8:49731612..49731890 ACGAGAACAGGTCGGACAGT Chr8:49731619..49731638 59.76 55
upstream ENSMUSE00000683598 Chr8:49641232..49641393 No primer for this exon
upstream ENSMUSE00000683604 Chr8:49641069..49641200 GTGTGATGAAGCCTGTGCTG Chr8:49641132..49641151 60.47 55
upstream ENSMUSE00000683611 Chr8:49640507..49641047 GCGTGAGTGTGTGTGTGTGT Chr8:49640924..49640943 59.2 55
upstream ENSMUSE00000491981 Chr8:49502362..49502599 CGTCCATCACTTCCCTCAAT Chr8:49502499..49502518 59.93 50
upstream ENSMUSE00000683610 Chr8:49502362..49502599 CGTCCATCACTTCCCTCAAT Chr8:49502499..49502518 59.93 50
upstream ENSMUSE00000683616 Chr8:49502362..49502603 CGTCCATCACTTCCCTCAAT Chr8:49502499..49502518 59.93 50

*** Putative Vector Insertion (Chr 8: 49502361 - 49641048) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000498613 Chr8:49480790..49481028 TACTGAACAGTGGCGTCGTC Chr8:49480960..49480979 59.9 55
downstream ENSMUSE00000712351 Chr8:49480790..49481028 TACTGAACAGTGGCGTCGTC Chr8:49480960..49480979 59.9 55
downstream ENSMUSE00000720986 Chr8:49480790..49481028 TACTGAACAGTGGCGTCGTC Chr8:49480960..49480979 59.9 55
downstream ENSMUSE00000496270 Chr8:49452665..49452787 ATTGTCGCCAGAAGGTAACG Chr8:49452644..49452663 60.13 50
downstream ENSMUSE00000517019 Chr8:49434553..49434767 CTGAGTATGGGAAGGCGGTA Chr8:49434531..49434550 60.09 55
downstream ENSMUSE00000515724 Chr8:49428586..49428796 AGGAGACCTGCTCTGGGTTT Chr8:49428582..49428601 60.25 55
downstream ENSMUSE00000521004 Chr8:49427969..49428070 TAGAAACCCGGGGAAACAAT Chr8:49427966..49427985 60.53 45
downstream ENSMUSE00000582361 Chr8:49427611..49427805 AGTATTGCCCGTTGCCACTA Chr8:49427745..49427764 60.52 50
downstream ENSMUSE00000480622 Chr8:49426308..49426508 ATGGATACACACCCCGTGAT Chr8:49426440..49426459 59.93 50
downstream ENSMUSE00000582360 Chr8:49420943..49421128 AGCCTTCTTCACAGCGACAG Chr8:49421038..49421057 60.73 55
downstream ENSMUSE00000683607 Chr8:49420107..49421128 GGGAGAAGCATTCATGGGTA Chr8:49420785..49420804 59.89 50
downstream ENSMUSE00000501367 Chr8:49398592..49398618 No primer for this exon
downstream ENSMUSE00000582359 Chr8:49395977..49396123 TCTCCATGGCTACGTCACAG Chr8:49395988..49396007 59.85 55
downstream ENSMUSE00000503811 Chr8:49386109..49386325 CACGACAGTAGGGCTGGTTT Chr8:49386232..49386251 60.17 55
downstream ENSMUSE00000265168 Chr8:49384948..49385067 CACGTTGACGCCAATAAGTG Chr8:49384979..49384998 60.17 50
downstream ENSMUSE00000582358 Chr8:49384140..49384401 GAATGGGGAACGCTCAAATA Chr8:49384319..49384338 59.9 45
downstream ENSMUSE00000265150 Chr8:49378861..49379128 GCCTCTGACAAGCCGTAGAC Chr8:49378844..49378863 60.02 60
downstream ENSMUSE00000265144 Chr8:49377473..49377616 TGTTCGAAGCATCCAACTCA Chr8:49377499..49377518 60.39 45
downstream ENSMUSE00000265138 Chr8:49373145..49373394 AGTTTGTTCCCGTCAGCTTG Chr8:49373237..49373256 60.29 50
downstream ENSMUSE00000396569 Chr8:49372487..49372507 No primer for this exon
downstream ENSMUSE00000265121 Chr8:49364312..49364544 CGATAGATTCTGCGGGTGTT Chr8:49364433..49364452 60.1 50
downstream ENSMUSE00000582357 Chr8:49363021..49363175 GGAGCCCAGGAGAGTTGATA Chr8:49363056..49363075 59.24 55
downstream ENSMUSE00000265104 Chr8:49361384..49362258 CTTTTCAGACACCCGTTGGT Chr8:49361464..49361483 60.01 50
downstream ENSMUSE00000448341 Chr8:49342186..49342361 GTCCACCGTGATAGCCTTGT Chr8:49342246..49342265 60 55
downstream ENSMUSE00000448330 Chr8:49339764..49339999 CTCACCGGGAAGAGTCATGT Chr8:49339823..49339842 60.11 55
downstream ENSMUSE00000448322 Chr8:49325599..49325895 CTTGGTGGTCCGATCAAAGT Chr8:49325826..49325845 59.97 50
downstream ENSMUSE00000448312 Chr8:49320644..49322255 TTACCCGGCCCATATTATCA Chr8:49321498..49321517 60 45
downstream ENSMUSE00000448303 Chr8:49317362..49317492 AGATGGAAGCCAAACGTCAC Chr8:49317434..49317453 60.12 50
downstream ENSMUSE00000683615 Chr8:49313059..49314555 AGAGTCCGGTTTGGATTGTG Chr8:49313724..49313743 59.97 50
downstream ENSMUSE00000607823 Chr8:49313036..49314555 AGAGTCCGGTTTGGATTGTG Chr8:49313724..49313743 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr8:49523978..49523998 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGGTGTGCCACTGTAGAA Chr8:49616998..49617018 59.74 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031561