Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32214
Trapped Gene
Cramp1l (ENSMUSG00000038002)
Vector Insertion
Chr 17: 25116430 - 25120342
Public Clones IST14758D11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000510344 (Chr17:25119169..25120341 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCTCACACTGGCTGAAGT Chr17:25119362..25119381 60.06 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000510344 (Chr17:25119169..25120341 -)
Downstram Exon
ENSMUSE00000297812 (Chr17:25116431..25116608 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCTCACACTGGCTGAAGT Chr17:25119362..25119381 60.06 55 CTTGTTGCTTCGGAGGGTAG Chr17:25116443..25116462 59.87 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702103 Chr17:25152072..25152171 GTTTCGCTCCCTAGCACAAT Chr17:25152116..25152135 59.34 50
upstream ENSMUSE00000476785 Chr17:25150633..25150970 GCACCATTTCCTAAGGTCCA Chr17:25150723..25150742 59.93 50
upstream ENSMUSE00000414730 Chr17:25150618..25150969 GCACCATTTCCTAAGGTCCA Chr17:25150723..25150742 59.93 50
upstream ENSMUSE00000297416 Chr17:25148247..25148356 GTGATGGGAGTTTGGGAAGA Chr17:25148298..25148317 59.9 50
upstream ENSMUSE00000474340 Chr17:25140157..25140350 CCCGGAACATAGGATCTTCA Chr17:25140250..25140269 59.89 50
upstream ENSMUSE00000474954 Chr17:25134398..25134551 GTCCGGCATTTTTACTACCG Chr17:25134439..25134458 59.47 50
upstream ENSMUSE00000472269 Chr17:25131531..25131614 TCTCTCGAGGGCTGAAGAAG Chr17:25131592..25131611 59.82 55
upstream ENSMUSE00000473413 Chr17:25129215..25129263 No primer for this exon
upstream ENSMUSE00000470687 Chr17:25122467..25122552 AGGGAGAAATCTCCGGATCA Chr17:25122512..25122531 60.93 50
upstream ENSMUSE00000513989 Chr17:25121920..25122043 AAGAGGACCAGAAGCCAGTG Chr17:25122012..25122031 59.45 55
upstream ENSMUSE00000514967 Chr17:25120889..25120970 GGCACTCCATGAAGTACGAA Chr17:25120891..25120910 58.72 50
upstream ENSMUSE00000510344 Chr17:25119169..25120341 AGCCTCACACTGGCTGAAGT Chr17:25119362..25119381 60.06 55
upstream ENSMUSE00000297812 Chr17:25116431..25116608 CTACCCTCCGAAGCAACAAG Chr17:25116465..25116484 59.87 55

*** Putative Vector Insertion (Chr 17: 25116430 - 25120342) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000297796 Chr17:25114441..25114622 AAGTCGTTGGGACAGCAAAG Chr17:25114505..25114524 60.29 50
downstream ENSMUSE00000297779 Chr17:25114277..25114351 TGCCGTTTCCGTAGTTTCTT Chr17:25114280..25114299 59.75 45
downstream ENSMUSE00000297761 Chr17:25111650..25111731 TGGGACTGGTTTTCAGAAGG Chr17:25111672..25111691 60.08 50
downstream ENSMUSE00000297744 Chr17:25110449..25110553 CACTATCGGTCGAGACAGAGC Chr17:25110467..25110487 60.03 57.14
downstream ENSMUSE00000297730 Chr17:25110026..25110204 AAGGGACTTCCAGGGATGAT Chr17:25110131..25110150 59.76 50
downstream ENSMUSE00000297714 Chr17:25109281..25109346 ATCTGTCATTGGCTCCTGCT Chr17:25109268..25109287 59.83 50
downstream ENSMUSE00000297694 Chr17:25108322..25108553 TAGCCTTGGACAGCTCAGGT Chr17:25108492..25108511 60.01 55
downstream ENSMUSE00000297670 Chr17:25107360..25107524 CGAACAAGCTGCTGAGTGAG Chr17:25107338..25107357 59.92 55
downstream ENSMUSE00000297655 Chr17:25105871..25106016 TTCCATCCAACAAGCTAGGG Chr17:25105896..25105915 60.07 50
downstream ENSMUSE00000462473 Chr17:25098248..25101891 ATCTGATGCCGCTTGCTACT Chr17:25099347..25099366 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTGCAGATAATCGCCTTGC Chr17:25117279..25117299 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTTCAAGCACAGTGCAGAC Chr17:25117290..25117310 59.47 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038002