Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32227
Trapped Gene
Zpbp (ENSMUSG00000020193)
Vector Insertion
Chr 11: 11252524 - 11304061
Public Clones IST13291A11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000101671 (Chr11:11303984..11304060 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000101671 (Chr11:11303984..11304060 -)
Downstram Exon
ENSMUSE00000221615 (Chr11:11252525..11252702 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000371105 Chr11:11362067..11362411 No primer for this exon
upstream ENSMUSE00000221642 Chr11:11359702..11359782 No primer for this exon
upstream ENSMUSE00000221634 Chr11:11318165..11318290 No primer for this exon
upstream ENSMUSE00000101677 Chr11:11315191..11315340 No primer for this exon
upstream ENSMUSE00000101674 Chr11:11308392..11308610 No primer for this exon
upstream ENSMUSE00000101671 Chr11:11303984..11304060 No primer for this exon
upstream ENSMUSE00000221615 Chr11:11252525..11252702 No primer for this exon

*** Putative Vector Insertion (Chr 11: 11252524 - 11304061) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000379178 Chr11:11182516..11182700 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCAGATTTAGGCAACAAGG Chr11:11280035..11280055 59.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCAGATTTAGGCAACAAGG Chr11:11280035..11280055 59.71 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020193