Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32228
Trapped Gene
Dync2h1 (ENSMUSG00000047193)
Vector Insertion
Chr 9: 7084933 - 7101188
Public Clones IST13291A11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000539991 (Chr9:7101074..7101187 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGCCTTTGCTATTGCCACT Chr9:7101133..7101152 59.48 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000539991 (Chr9:7101074..7101187 -)
Downstram Exon
ENSMUSE00000540006 (Chr9:7084934..7085076 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGCCTTTGCTATTGCCACT Chr9:7101133..7101152 59.48 50 CCATAGCACCTGGCATTTCT Chr9:7084945..7084964 60.1 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000539988 Chr9:7176763..7177046 CCAGAATTACTTCGGGCTGA Chr9:7176888..7176907 60.21 50
upstream ENSMUSE00000303467 Chr9:7175242..7175412 GTTTTTCAAGCTCCGACCAG Chr9:7175358..7175377 59.85 50
upstream ENSMUSE00000303449 Chr9:7174740..7174875 ACCAGGAATGGAGCAGAAAC Chr9:7174855..7174874 59.14 50
upstream ENSMUSE00000303439 Chr9:7172803..7172921 TCATCGTGGAAGCAAACAGA Chr9:7172856..7172875 60.39 45
upstream ENSMUSE00000303428 Chr9:7170862..7171006 ATGTGTGGCGACAGACAGAG Chr9:7170911..7170930 59.9 55
upstream ENSMUSE00000303414 Chr9:7169477..7169709 GCTGGCATTTCAATTTGTGA Chr9:7169601..7169620 59.67 40
upstream ENSMUSE00000303395 Chr9:7168678..7168812 GCCTGTCTCGGGTATTTGAG Chr9:7168723..7168742 59.69 55
upstream ENSMUSE00000303369 Chr9:7168459..7168572 ATCATTGCACCTGCAGAACA Chr9:7168517..7168536 60.27 45
upstream ENSMUSE00000303334 Chr9:7168254..7168365 TTGGTGAAGCGTCCCACTAT Chr9:7168316..7168335 60.52 50
upstream ENSMUSE00000303300 Chr9:7167117..7167241 TTGTTTGGGTTCGTCAGTTG Chr9:7167126..7167145 59.58 45
upstream ENSMUSE00000303271 Chr9:7165599..7165774 TTTCATCGGAGTGCTGAAGA Chr9:7165695..7165714 59.52 45
upstream ENSMUSE00000372677 Chr9:7162731..7162926 GAAGTCCGTCAGCTTTCTGC Chr9:7162816..7162835 60.14 55
upstream ENSMUSE00000303583 Chr9:7160154..7160249 AGTCAGAGGCCAATGATGCT Chr9:7160188..7160207 59.83 50
upstream ENSMUSE00000303565 Chr9:7159481..7159633 AAAATGCTGCTGAGCGACTT Chr9:7159532..7159551 60.16 45
upstream ENSMUSE00000303542 Chr9:7158829..7158927 AACTGGCTTAGCGACTGTGG Chr9:7158837..7158856 60.45 55
upstream ENSMUSE00000389002 Chr9:7157893..7158032 CCAGTATCAAGTGGGTCTGGA Chr9:7157941..7157961 59.97 52.38
upstream ENSMUSE00000346014 Chr9:7157552..7157780 TTGAAGAAATCCGGGCTAAA Chr9:7157732..7157751 59.65 40
upstream ENSMUSE00000400009 Chr9:7155081..7155208 TGTGCATGATTGGGAGAAAA Chr9:7155130..7155149 60.05 40
upstream ENSMUSE00000539974 Chr9:7148625..7148740 CAGCCCTGTGAAGACTGTGA Chr9:7148688..7148707 60.02 55
upstream ENSMUSE00000539973 Chr9:7147683..7147810 No primer for this exon
upstream ENSMUSE00000539972 Chr9:7145549..7145698 AGTGGGACAAATTCGAGCTG Chr9:7145585..7145604 60.26 50
upstream ENSMUSE00000539971 Chr9:7144138..7144343 CCATGGATCAAAGTGCAAAG Chr9:7144197..7144216 59.12 45
upstream ENSMUSE00000539970 Chr9:7142857..7143012 GTGCACAGATTTGGGCTCTT Chr9:7142916..7142935 60.26 50
upstream ENSMUSE00000539969 Chr9:7142650..7142764 TTGCAGTCAGAAGTGGACAGA Chr9:7142656..7142676 59.61 47.62
upstream ENSMUSE00000539968 Chr9:7142200..7142370 CAGACCACTGGCTTGACCTT Chr9:7142305..7142324 60.3 55
upstream ENSMUSE00000539967 Chr9:7140899..7141281 TCTATGGGGAGTTGGAGCAG Chr9:7141203..7141222 60.21 55
upstream ENSMUSE00000539966 Chr9:7139374..7139506 CAGCTTCAAAGATGCCAGAA Chr9:7139396..7139415 59.15 45
upstream ENSMUSE00000539965 Chr9:7139161..7139278 TCCTGGGCCAGTCAACTAAC Chr9:7139201..7139220 60.11 55
upstream ENSMUSE00000539964 Chr9:7136998..7137110 AACAGTGTGTGCTTTGATGAGG Chr9:7137084..7137105 60.22 45.46
upstream ENSMUSE00000539963 Chr9:7135019..7135138 CTGCTGGACGAAGTTCACAA Chr9:7135052..7135071 60.03 50
upstream ENSMUSE00000539956 Chr9:7134244..7134394 GTGTTTGGCAGAGCAGATCA Chr9:7134370..7134389 59.99 50
upstream ENSMUSE00000638787 Chr9:7131838..7132043 CTGGGCTTGGAAGAAACAAG Chr9:7131918..7131937 59.85 50
upstream ENSMUSE00000539958 Chr9:7130694..7130876 GAATCCCTATGGACCTGCTG Chr9:7130771..7130790 59.51 55
upstream ENSMUSE00000215718 Chr9:7129663..7129845 TGCAGATCCAGACCATTCAG Chr9:7129711..7129730 59.79 50
upstream ENSMUSE00000215717 Chr9:7128956..7129179 AATTGGTCGCCATTTTCAAC Chr9:7128964..7128983 59.81 40
upstream ENSMUSE00000540003 Chr9:7128158..7128273 TATGATTGGGGGTTGAGAGC Chr9:7128229..7128248 59.89 50
upstream ENSMUSE00000540002 Chr9:7125731..7125930 GCGGTTTGATGCACTGATTA Chr9:7125838..7125857 59.69 45
upstream ENSMUSE00000540000 Chr9:7124732..7124996 GAGTGGTCAGATGGCGTTTT Chr9:7124770..7124789 60.12 50
upstream ENSMUSE00000539999 Chr9:7122608..7122815 GATAATCGGCTGCTCACCAT Chr9:7122722..7122741 60.07 50
upstream ENSMUSE00000539998 Chr9:7120809..7120938 TGGTTGAGGAATCAGCCTCT Chr9:7120882..7120901 59.8 50
upstream ENSMUSE00000539997 Chr9:7118831..7118986 TCTGGTTGGGACTGTGATGA Chr9:7118944..7118963 60.09 50
upstream ENSMUSE00000539996 Chr9:7117395..7117654 CAGGCCAATGGACACCTACT Chr9:7117597..7117616 59.99 55
upstream ENSMUSE00000539995 Chr9:7116394..7116640 TGAGCCAGACTTGCATGGTA Chr9:7116523..7116542 60.41 50
upstream ENSMUSE00000638777 Chr9:7114865..7115016 TTGTCCGTCTTTGTGCCATA Chr9:7114867..7114886 60.11 45
upstream ENSMUSE00000638774 Chr9:7113086..7113230 AGGCTCTATGGTGCAGGTGT Chr9:7113094..7113113 59.75 55
upstream ENSMUSE00000540013 Chr9:7112048..7112150 GCCAAATTCACAGTGGATGA Chr9:7112125..7112144 59.5 45
upstream ENSMUSE00000540012 Chr9:7111425..7111592 ACGTGCTGGAAATTGTAGCC Chr9:7111549..7111568 60.14 50
upstream ENSMUSE00000540011 Chr9:7103655..7103785 TTTACCTCCACACGGGAAAC Chr9:7103702..7103721 59.83 50
upstream ENSMUSE00000540010 Chr9:7102311..7102559 ATGGTGCTGTGCTCTTCTCC Chr9:7102365..7102384 60.42 55
upstream ENSMUSE00000540009 Chr9:7101492..7101600 CTTGCAGGAATTGAAGCACA Chr9:7101572..7101591 59.99 45
upstream ENSMUSE00000539991 Chr9:7101074..7101187 GAGCCTTTGCTATTGCCACT Chr9:7101133..7101152 59.48 50
upstream ENSMUSE00000540006 Chr9:7084934..7085076 AGAAATGCCAGGTGCTATGG Chr9:7084967..7084986 60.1 50

*** Putative Vector Insertion (Chr 9: 7084933 - 7101188) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000540005 Chr9:7083157..7083238 No primer for this exon
downstream ENSMUSE00000540004 Chr9:7081004..7081158 GTGGCCCCATAAGCTTTACA Chr9:7081073..7081092 59.96 50
downstream ENSMUSE00000638761 Chr9:7077872..7078009 TCCGCTTCATCCTGCTTTAT Chr9:7077884..7077903 59.81 45
downstream ENSMUSE00000638758 Chr9:7076213..7076326 No primer for this exon
downstream ENSMUSE00000638757 Chr9:7075762..7075922 TGAAAGAGATTCCGGCCTAA Chr9:7075844..7075863 59.78 45
downstream ENSMUSE00000638754 Chr9:7071801..7071924 TGGATCGAAAGAGGCTTTGT Chr9:7071782..7071801 59.81 45
downstream ENSMUSE00000638751 Chr9:7071008..7071129 CTTAACCCAAGCAGCCAAAG Chr9:7071057..7071076 59.88 50
downstream ENSMUSE00000638750 Chr9:7052561..7052647 No primer for this exon
downstream ENSMUSE00000638747 Chr9:7051370..7051496 TTCTGACGTCCTGCTCTGAA Chr9:7051453..7051472 59.7 50
downstream ENSMUSE00000638745 Chr9:7050342..7050483 CCTTGGTCCACTCTTCCAGA Chr9:7050335..7050354 60.23 55
downstream ENSMUSE00000638743 Chr9:7049083..7049192 AGAAACCGCCTGAGATCAAA Chr9:7049149..7049168 59.81 45
downstream ENSMUSE00000638740 Chr9:7044330..7044428 TTAGCCACTCTGTTGCCTGA Chr9:7044352..7044371 59.59 50
downstream ENSMUSE00000638739 Chr9:7041602..7041725 TCTACCCCGTCCATCTCTTG Chr9:7041624..7041643 60.06 55
downstream ENSMUSE00000638736 Chr9:7037653..7037816 CACCTCAGTCACGATGGATG Chr9:7037667..7037686 60.11 55
downstream ENSMUSE00000638733 Chr9:7035600..7035719 AGGTTTTTCATGCTGAATGGTT Chr9:7035665..7035686 59.88 36.36
downstream ENSMUSE00000638732 Chr9:7034990..7035124 TGATCCAGGGAAATCTGGAG Chr9:7034969..7034988 60 50
downstream ENSMUSE00000638729 Chr9:7031641..7031784 AGAGCTCGCTGAAAAAGTCG Chr9:7031632..7031651 59.9 50
downstream ENSMUSE00000638727 Chr9:7023311..7023400 No primer for this exon
downstream ENSMUSE00000638726 Chr9:7016730..7016795 TGCATTCCTCGAACAAAATG Chr9:7016730..7016749 59.66 40
downstream ENSMUSE00000638725 Chr9:7015474..7015524 CCAACAACCACACCTGTGAA Chr9:7015471..7015490 60.45 50
downstream ENSMUSE00000638724 Chr9:7014139..7014216 AGATGGAAGCTGATCACGAA Chr9:7014159..7014178 58.39 45
downstream ENSMUSE00000585148 Chr9:7011173..7011304 CCCCATCTTCCAAACAGAGA Chr9:7011237..7011256 60.04 50
downstream ENSMUSE00000215735 Chr9:7009971..7010043 GAGCCATGGCACTCTGTAGTC Chr9:7009970..7009990 59.89 57.14
downstream ENSMUSE00000215731 Chr9:7006716..7006876 CAATCTCGAGGGTCTCCTTG Chr9:7006789..7006808 59.8 55
downstream ENSMUSE00000215732 Chr9:7005490..7005615 CATTTCGGGCACATTCTTTT Chr9:7005530..7005549 59.94 40
downstream ENSMUSE00000215720 Chr9:7002556..7002666 TGGGATGAACTTCTGCAGTG Chr9:7002581..7002600 59.83 50
downstream ENSMUSE00000215734 Chr9:7001341..7001496 AAAGAGCATGAGCTCGGTGT Chr9:7001375..7001394 60.02 50
downstream ENSMUSE00000215728 Chr9:6996864..6996939 No primer for this exon
downstream ENSMUSE00000215733 Chr9:6993938..6994146 GCCGTGTACAAATTCCCACT Chr9:6994090..6994109 59.86 50
downstream ENSMUSE00000215727 Chr9:6992524..6992628 TCGATGACAGCACGGTAGTC Chr9:6992587..6992606 59.86 55
downstream ENSMUSE00000215723 Chr9:6983390..6983506 CAAGATCCTGAGCTGGGAGA Chr9:6983461..6983480 60.49 55
downstream ENSMUSE00000215722 Chr9:6967080..6967289 TGGCATTGAACTGCTCAAGA Chr9:6967174..6967193 60.54 45
downstream ENSMUSE00000215725 Chr9:6955907..6955996 GCCACGAAGGTACTGGAGAG Chr9:6955912..6955931 59.87 60
downstream ENSMUSE00000215721 Chr9:6941595..6941704 TCCTGGCGAAGAGCATTAAG Chr9:6941582..6941601 60.48 50
downstream ENSMUSE00000215726 Chr9:6940543..6940624 GCTTCTTGAAGTCGGCCTTT Chr9:6940537..6940556 60.88 50
downstream ENSMUSE00000215724 Chr9:6935239..6935355 AGCCCATGTAGCAAGGAAGA Chr9:6935228..6935247 59.84 50
downstream ENSMUSE00000396273 Chr9:6928503..6929623 AGTGTTGCAGCAATCGTCAC Chr9:6929393..6929412 59.91 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATTTAATCGCCTTGCAGCAC Chr9:7095120..7095141 60.24 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTATTCGTGACTGGGAAA Chr9:7095124..7095144 59.27 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047193