Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32229
Trapped Gene
Synpr (ENSMUSG00000056296)
Vector Insertion
Chr 14: 14117721 - 14286570
Public Clones IST12560H7 (tigm) IST13291A11 (tigm) IST11993C3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000475796 (Chr14:14117655..14117720 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000475796 (Chr14:14117655..14117720 +)
Downstram Exon
ENSMUSE00000692579 (Chr14:14286571..14286866 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CACCAGCTCTTGTCCCTCTC Chr14:14286758..14286777 59.99 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000650916 Chr14:14117294..14117516 CTGAAGGGAACTGGTTCGAG Chr14:14117456..14117475 59.84 55
upstream ENSMUSE00000475796 Chr14:14117655..14117720 No primer for this exon

*** Putative Vector Insertion (Chr 14: 14117721 - 14286570) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000692579 Chr14:14286571..14286866 CACCAGCTCTTGTCCCTCTC Chr14:14286758..14286777 59.99 60
downstream ENSMUSE00000454305 Chr14:14326022..14326146 GGTACGCAAACGCTATGTCA Chr14:14326142..14326161 59.76 50
downstream ENSMUSE00000453636 Chr14:14395432..14395630 GAGGAGTCTCCAACCAATGC Chr14:14395512..14395531 59.66 55
downstream ENSMUSE00000453632 Chr14:14441084..14441275 CACTTGTTGGAAGGCTGCTT Chr14:14441232..14441251 60.43 50
downstream ENSMUSE00000472199 Chr14:14446238..14447973 CCCACCACTTGACCCATAAC Chr14:14446411..14446430 60.09 55
downstream ENSMUSE00000692578 Chr14:14446238..14447868 CCCACCACTTGACCCATAAC Chr14:14446411..14446430 60.09 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr14:14177769..14177789 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAATCCGTGACTGGGAAAAC Chr14:14177767..14177787 59.39 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056296