Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32238
Trapped Gene
Ankrd10 (ENSMUSG00000031508)
Vector Insertion
Chr 8: 11632865 - 11635755
Public Clones IST14461E8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000210344 (Chr8:11635411..11635754 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTCCTTTGTGTTCGAGTGG Chr8:11635688..11635707 59.72 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000210344 (Chr8:11635411..11635754 -)
Downstram Exon
ENSMUSE00000210341 (Chr8:11632866..11633018 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTCCTTTGTGTTCGAGTGG Chr8:11635688..11635707 59.72 50 GGGTGGTCGAGACATTCAGT Chr8:11632939..11632958 59.97 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000210344 Chr8:11635411..11635754 TGTCCTTTGTGTTCGAGTGG Chr8:11635688..11635707 59.72 50
upstream ENSMUSE00000210341 Chr8:11632866..11633018 GCAGGAGCCTCACTGAATGT Chr8:11632972..11632991 60.42 55

*** Putative Vector Insertion (Chr 8: 11632865 - 11635755) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000210346 Chr8:11628439..11628530 CCTTGTGAATGGGAGTTTCC Chr8:11628478..11628497 59.38 50
downstream ENSMUSE00000210342 Chr8:11619062..11619297 GAAACGGCTCATTTGATGGT Chr8:11619167..11619186 59.94 45
downstream ENSMUSE00000210345 Chr8:11615815..11615910 TCTGTCGGCATCATCTTCAG Chr8:11615827..11615846 59.94 50
downstream ENSMUSE00000210343 Chr8:11611583..11612947 GCACAGAGCAGCACTCTACG Chr8:11612334..11612353 59.95 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr8:11635684..11635704 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000031508