Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32247
Trapped Gene
Cnpy3 (ENSMUSG00000023973)
Vector Insertion
Chr 17: 46874675 - 46880232
Public Clones IST12132G11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000386453 (Chr17:46880135..46880231 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGACTACAGCCTGCACAAG Chr17:46880165..46880184 60.05 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000386453 (Chr17:46880135..46880231 -)
Downstram Exon
ENSMUSE00000340567 (Chr17:46874676..46874798 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGACTACAGCCTGCACAAG Chr17:46880165..46880184 60.05 55 CTAGGTTGTGCAGCGTCTCA Chr17:46874740..46874759 60.2 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000378046 Chr17:46888922..46889135 CCGCTGCCTCTTATTTCCTT Chr17:46889027..46889046 60.7 50
upstream ENSMUSE00000720874 Chr17:46888922..46889144 CCGCTGCCTCTTATTTCCTT Chr17:46889027..46889046 60.7 50
upstream ENSMUSE00000136887 Chr17:46884370..46884493 AGCTGAAGTCGGCTTTTGAG Chr17:46884453..46884472 59.76 50
upstream ENSMUSE00000719241 Chr17:46883936..46884149 GGAGACCCTCAGGGGTTAAG Chr17:46884037..46884056 59.93 60
upstream ENSMUSE00000386453 Chr17:46880135..46880231 TGGACTACAGCCTGCACAAG Chr17:46880165..46880184 60.05 55
upstream ENSMUSE00000340567 Chr17:46874676..46874798 GCTGCACAACCTAGTCCACA Chr17:46874756..46874775 59.9 55

*** Putative Vector Insertion (Chr 17: 46874675 - 46880232) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136886 Chr17:46874124..46874241 AACTCTTCCACCAGCACGTC Chr17:46874197..46874216 60.31 55
downstream ENSMUSE00000380834 Chr17:46872707..46873857 ATCGATGAGGGGACACTCTG Chr17:46872918..46872937 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGCTTCTGTAATCGCCTTG Chr17:46880170..46880190 59.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGAGGCTTCTGCGTGACTG Chr17:46880173..46880193 60.73 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023973