Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32248
Trapped Gene
Park2 (ENSMUSG00000023826)
Vector Insertion
Chr 17: 12196995 - 12243491
Public Clones (sanger) (sanger) IST15074H7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000429026 (Chr17:12196911..12196994 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTTTCTGCCGGGACTGTAA Chr17:12196914..12196933 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000429026 (Chr17:12196911..12196994 +)
Downstram Exon
ENSMUSE00000470638 (Chr17:12243492..12243609 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTTTCTGCCGGGACTGTAA Chr17:12196914..12196933 60.11 50 GACAAGGCTTGGTGGTCTTC Chr17:12243582..12243601 59.7 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000485440 Chr17:11259991..11260158 GAGCTTCCGAATCACCTGAC Chr17:11260132..11260151 59.81 55
upstream ENSMUSE00000703888 Chr17:11259992..11260158 GAGCTTCCGAATCACCTGAC Chr17:11260132..11260151 59.81 55
upstream ENSMUSE00000464625 Chr17:11430328..11430568 TCCATATGGGAGTCCAGGAG Chr17:11430439..11430458 59.88 55
upstream ENSMUSE00000703887 Chr17:11433083..11433111 No primer for this exon
upstream ENSMUSE00000479958 Chr17:11496459..11496577 CTGGAAAGCTCCGAGTTCAG Chr17:11496519..11496538 60.13 55
upstream ENSMUSE00000482806 Chr17:11627416..11627499 AATTCCAAACCGGATGAGTG Chr17:11627442..11627461 59.79 45
upstream ENSMUSE00000481965 Chr17:11685545..11685660 TTTGAACCTGATCACCAGCA Chr17:11685601..11685620 60.24 45
upstream ENSMUSE00000477260 Chr17:11828176..11828312 TTCCAGTGTAACCACCGTCA Chr17:11828192..11828211 60 50
upstream ENSMUSE00000429057 Chr17:12031468..12031529 No primer for this exon
upstream ENSMUSE00000429034 Chr17:12047593..12047742 GTGGAGCTGGACTGCTACCT Chr17:12047669..12047688 59.48 60
upstream ENSMUSE00000429026 Chr17:12196911..12196994 GTTTTCTGCCGGGACTGTAA Chr17:12196914..12196933 60.11 50

*** Putative Vector Insertion (Chr 17: 12196995 - 12243491) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000470638 Chr17:12243492..12243609 GACAAGGCTTGGTGGTCTTC Chr17:12243582..12243601 59.7 55
downstream ENSMUSE00000510700 Chr17:12254407..12256227 TGACAGTCTGGGTACCACCA Chr17:12256201..12256220 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATTCCCGTACCAACTCTGC Chr17:12241995..12242015 60.52 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTAGTCACAGGGGAACGTG Chr17:12242030..12242050 60.71 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023826