Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32250
Trapped Gene
Adarb2 (ENSMUSG00000052551)
Vector Insertion
Chr 13: 8202567 - 8558349
Public Clones (sanger) (sanger) IST13650E8 (tigm) IST13830A1 (tigm) IST10905G11 (tigm)
IST13410G12 (tigm) IST11389E1 (tigm) IST15087F10 (tigm) IST14414F4 (tigm)
IST11406F1 (tigm) IST14649H5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000471563 (Chr13:8202467..8202566 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGGGTCTGGAGGGCTAAG Chr13:8202491..8202510 59.83 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000471563 (Chr13:8202467..8202566 +)
Downstram Exon
ENSMUSE00000468343 (Chr13:8558350..8558436 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGGGTCTGGAGGGCTAAG Chr13:8202491..8202510 59.83 60 GGAGCAAGGAAGGTTGACAG Chr13:8558386..8558405 59.84 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000471563 Chr13:8202467..8202566 AGAGGGTCTGGAGGGCTAAG Chr13:8202491..8202510 59.83 60

*** Putative Vector Insertion (Chr 13: 8202567 - 8558349) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000468343 Chr13:8558350..8558436 GGAGCAAGGAAGGTTGACAG Chr13:8558386..8558405 59.84 55
downstream ENSMUSE00000465454 Chr13:8568913..8569820 AGGCACACATACCGAAGACC Chr13:8569627..8569646 60 55
downstream ENSMUSE00000476554 Chr13:8671651..8671765 GACGATTCCTGCCAGTGTTT Chr13:8671758..8671777 60.12 50
downstream ENSMUSE00000441669 Chr13:8696866..8697034 CCACGATCTCAGCATGACAG Chr13:8696985..8697004 60.43 55
downstream ENSMUSE00000441655 Chr13:8700826..8700977 TTTCTCGCAGCCTGTAACCT Chr13:8700899..8700918 60.01 50
downstream ENSMUSE00000441646 Chr13:8712846..8713014 CTGACGATGTGTTTGCTGCT Chr13:8712873..8712892 60.06 50
downstream ENSMUSE00000441662 Chr13:8731036..8731217 AGGCCTGTTTTGTCGGTATG Chr13:8731210..8731229 59.99 50
downstream ENSMUSE00000455934 Chr13:8751819..8751997 TGAAGTGGGGAGACTTTCCT Chr13:8751869..8751888 58.72 50
downstream ENSMUSE00000684878 Chr13:8756472..8759554 GCATAGGCCAAAGTGATGGT Chr13:8758877..8758896 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGGATTAATCGCCTTGCAG Chr13:8424612..8424632 60.06 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTGTACTCAGGACCAAAGA Chr13:8424520..8424541 59.34 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052551