Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32251
Trapped Gene
Akap6 (ENSMUSG00000061603)
Vector Insertion
Chr 12: 53800430 - 53896823
Public Clones (sanger) (sanger) (sanger) IST13650E8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000685083 (Chr12:53800370..53800429 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000685083 (Chr12:53800370..53800429 +)
Downstram Exon
ENSMUSE00000614502 (Chr12:53896824..53897187 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCACGGTAGGTGTCATGTTG Chr12:53896963..53896982 59.87 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000685083 Chr12:53800370..53800429 No primer for this exon

*** Putative Vector Insertion (Chr 12: 53800430 - 53896823) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000614502 Chr12:53896824..53897187 CCACGGTAGGTGTCATGTTG Chr12:53896963..53896982 59.87 55
downstream ENSMUSE00000113868 Chr12:53981626..53981877 CAGGGAGAACTCCGTCTCAA Chr12:53981697..53981716 60.38 55
downstream ENSMUSE00000113870 Chr12:53987296..53989050 ACACCTCCGTTTGTTTGAGG Chr12:53988634..53988653 60.01 50
downstream ENSMUSE00000685081 Chr12:54003903..54003905 No primer for this exon
downstream ENSMUSE00000113871 Chr12:54012788..54012910 CATGGCTTCGTTTAGCCACT Chr12:54012841..54012860 60.27 50
downstream ENSMUSE00000113859 Chr12:54038122..54038218 GCTTTGTGAGACGCAATGAG Chr12:54038219..54038238 59.6 50
downstream ENSMUSE00000113861 Chr12:54039330..54039493 AGCCAGTATCTCGGCTTTGA Chr12:54039451..54039470 59.98 50
downstream ENSMUSE00000113858 Chr12:54111461..54111609 ATCTGCTCCACAGCGTCTCT Chr12:54111516..54111535 60.17 55
downstream ENSMUSE00000113863 Chr12:54126708..54126828 GCTGTCCATCACAAGGGACT Chr12:54126786..54126805 60.12 55
downstream ENSMUSE00000113867 Chr12:54170094..54170240 TGGACATTTCCACGCTGTAG Chr12:54170118..54170137 59.72 50
downstream ENSMUSE00000113865 Chr12:54173277..54173498 CTGACCTCCAGCTGCCTTAC Chr12:54173389..54173408 60.01 60
downstream ENSMUSE00000113873 Chr12:54205502..54205717 CACTGGACAGCTTGCATGAC Chr12:54205683..54205702 60.47 55
downstream ENSMUSE00000614500 Chr12:54240368..54243755 GCTCTTCTTCCGTCAAGGTG Chr12:54242084..54242103 59.99 55
downstream ENSMUSE00000614501 Chr12:54248798..54252002 AAACGCTCCATGTCAGCTCT Chr12:54250792..54250811 60.02 50
downstream ENSMUSE00000685080 Chr12:54248798..54252002 AAACGCTCCATGTCAGCTCT Chr12:54250792..54250811 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCAGGTGGCTTATTCTAGTTC Chr12:53824403..53824425 59.29 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCAGGTGGCTTATTCTAGTTC Chr12:53824403..53824425 59.29 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000061603