Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32258
Trapped Gene
OTTMUSG00000015750 (ENSMUSG00000074736)
Vector Insertion
Chr 2: 149756779 - 149828912
Public Clones IST10046C12 (tigm) IST11720D10 (tigm) IST11015G5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000640273 (Chr2:149756641..149756778 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGGACTCAGCGTCTTCTC Chr2:149756704..149756723 60.13 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000640273 (Chr2:149756641..149756778 +)
Downstram Exon
ENSMUSE00000640272 (Chr2:149828913..149829264 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGGACTCAGCGTCTTCTC Chr2:149756704..149756723 60.13 60 CTTCTCTGCCCTCGTACAGC Chr2:149829134..149829153 60.16 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682153 Chr2:149656524..149656661 No primer for this exon
upstream ENSMUSE00000682149 Chr2:149656579..149656661 No primer for this exon
upstream ENSMUSE00000682146 Chr2:149656620..149656661 No primer for this exon
upstream ENSMUSE00000682148 Chr2:149722051..149722136 TTGCCCATTTTGACCCTTTA Chr2:149722113..149722132 60.29 40
upstream ENSMUSE00000712941 Chr2:149725154..149725711 GTGATGCTGGCAAAAGGAAT Chr2:149725281..149725300 60.08 45
upstream ENSMUSE00000715058 Chr2:149725154..149725711 GTGATGCTGGCAAAAGGAAT Chr2:149725281..149725300 60.08 45
upstream ENSMUSE00000640274 Chr2:149725232..149725711 GTGATGCTGGCAAAAGGAAT Chr2:149725281..149725300 60.08 45
upstream ENSMUSE00000640273 Chr2:149756641..149756778 CTGGGACTCAGCGTCTTCTC Chr2:149756704..149756723 60.13 60
upstream ENSMUSE00000682144 Chr2:149756641..149756695 CTCCAGCGACACAGAAAGTG Chr2:149756649..149756668 59.62 55

*** Putative Vector Insertion (Chr 2: 149756779 - 149828912) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000640272 Chr2:149828913..149829264 CTTCTCTGCCCTCGTACAGC Chr2:149829134..149829153 60.16 60
downstream ENSMUSE00000682150 Chr2:149828913..149830128 GCTGGGTATCTGCAAGAAGC Chr2:149829714..149829733 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGAAGCTAATAATCGCCTTG Chr2:149765820..149765841 60.07 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTATGCTTGGGGCAGAAAG Chr2:149765793..149765813 59.34 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074736