Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32259
Trapped Gene
AC163344.2 (ENSMUSG00000052724)
Vector Insertion
Chr 9: 114689430 - 114690415
Public Clones IST11420B5 (tigm) IST14792A3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000583059 (Chr9:114689218..114689429 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCACTCCCAGGACTTGGTC Chr9:114689290..114689309 59.68 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000583059 (Chr9:114689218..114689429 +)
Downstram Exon
ENSMUSE00000583058 (Chr9:114690416..114690599 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCACTCCCAGGACTTGGTC Chr9:114689290..114689309 59.68 60 GTAGAGCTCGGCGACAAGAG Chr9:114690464..114690483 60.3 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000583059 Chr9:114689218..114689429 CTCACTCCCAGGACTTGGTC Chr9:114689290..114689309 59.68 60

*** Putative Vector Insertion (Chr 9: 114689430 - 114690415) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000583058 Chr9:114690416..114690599 GTAGAGCTCGGCGACAAGAG Chr9:114690464..114690483 60.3 60
downstream ENSMUSE00000439089 Chr9:114690807..114691375 TTCCCCCTACTCGTGTCAGT Chr9:114691252..114691271 59.57 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCCCTGCTCCTCAGTCTCA Chr9:114689437..114689457 59.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATTCGTGACTGGGAAAAC Chr9:114689476..114689496 60.35 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052724