Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32266
Trapped Gene
4930519F16Rik (ENSMUSG00000031325)
Vector Insertion
Chr X: 100378511 - 100425514
Public Clones IST13705H12 (tigm) IST13270C8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000208296 (ChrX:100425367..100425513 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCAAAATCCCGCAGTCATC ChrX:100425412..100425431 60.47 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000208296 (ChrX:100425367..100425513 -)
Downstram Exon
ENSMUSE00000284297 (ChrX:100378512..100378622 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCAAAATCCCGCAGTCATC ChrX:100425412..100425431 60.47 50 TCAAAAGCAAAGCACCAGAA ChrX:100378537..100378556 59.58 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000548572 ChrX:100451858..100451944 TGCCAGTTGAGTCGAAATGA ChrX:100451912..100451931 60.39 45
upstream ENSMUSE00000208295 ChrX:100451163..100451331 TGGAAATCTACCACCAACGA ChrX:100451269..100451288 58.97 45
upstream ENSMUSE00000208299 ChrX:100429361..100429608 CGATGGGGATGAAATACCAC ChrX:100429439..100429458 60.01 50
upstream ENSMUSE00000208300 ChrX:100428141..100428280 AGTCAACCACGGGAAGACTG ChrX:100428145..100428164 60.15 55
upstream ENSMUSE00000409478 ChrX:100425446..100425513 GGGAACTAGTGGGCCTCATAC ChrX:100425450..100425470 59.84 57.14
upstream ENSMUSE00000208296 ChrX:100425367..100425513 GTCAAAATCCCGCAGTCATC ChrX:100425412..100425431 60.47 50
upstream ENSMUSE00000353299 ChrX:100424314..100425513 GAGGGATTCCCAAACCAAGT ChrX:100424536..100424555 60.17 50
upstream ENSMUSE00000284297 ChrX:100378512..100378622 GCAGGACCTTTAAAGCCAAG ChrX:100378603..100378622 58.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAACCAACGGTCACAGTGTCT ChrX:100401536..100401557 60.06 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAACTCCCCTCGTGACTG ChrX:100392455..100392475 62.01 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031325