Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32272
Trapped Gene
Mei1 (ENSMUSG00000068117)
Vector Insertion
Chr 15: 81946289 - 81953851
Public Clones IST14953F9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 82% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000556668 (Chr15:81946113..81946288 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCAACCGCTGTCAACTCCT Chr15:81946191..81946210 59.73 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000556668 (Chr15:81946113..81946288 +)
Downstram Exon
ENSMUSE00000556667 (Chr15:81953852..81953933 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCAACCGCTGTCAACTCCT Chr15:81946191..81946210 59.73 50 CAGCCAATACAGGCTTGAGA Chr15:81953889..81953908 59.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680669 Chr15:81912906..81912992 TCCACTGGGAAAACAGATGG Chr15:81912920..81912939 60.89 50
upstream ENSMUSE00000556693 Chr15:81913504..81913618 GGCCAGCTCCCACTGTATAA Chr15:81913536..81913555 60.1 55
upstream ENSMUSE00000556692 Chr15:81915244..81915360 GAGCATCTTTCGTCCTCCAG Chr15:81915255..81915274 59.95 55
upstream ENSMUSE00000556691 Chr15:81916561..81916660 GACCAACACGGAACTGCATA Chr15:81916604..81916623 59.57 50
upstream ENSMUSE00000556690 Chr15:81916766..81916900 CAGGCTGTTCACAAGCTCAG Chr15:81916781..81916800 59.77 55
upstream ENSMUSE00000556689 Chr15:81919938..81920052 GCTGAGCCGATGTATGGAGT Chr15:81920001..81920020 60.25 55
upstream ENSMUSE00000556688 Chr15:81921739..81921830 GAAACTCGGAGAAGGCCACT Chr15:81921755..81921774 60.77 55
upstream ENSMUSE00000556687 Chr15:81923049..81923190 CTCCCAGTGCAGAGAAGGAA Chr15:81923102..81923121 60.52 55
upstream ENSMUSE00000556686 Chr15:81924327..81924438 CTTTGTCATCATTCCCCACA Chr15:81924392..81924411 59.34 45
upstream ENSMUSE00000556685 Chr15:81926300..81926360 TTCATACGACTGACCCTGGA Chr15:81926311..81926330 59.09 50
upstream ENSMUSE00000556684 Chr15:81928431..81928528 CGTCCCTAAATCAGGTGTGC Chr15:81928436..81928455 60.52 55
upstream ENSMUSE00000556680 Chr15:81931378..81931546 TCAGATCGGCAGTATGTGGA Chr15:81931458..81931477 60.22 50
upstream ENSMUSE00000556679 Chr15:81931858..81932005 CCATGTATCTGCTGGCAGTG Chr15:81931956..81931975 60.29 55
upstream ENSMUSE00000556678 Chr15:81933570..81933845 GAAGAGAGCGGCTACGAGAA Chr15:81933723..81933742 59.86 55
upstream ENSMUSE00000556677 Chr15:81937460..81937625 CCTGATTGTCCTGAGGGTGT Chr15:81937501..81937520 59.96 55
upstream ENSMUSE00000556675 Chr15:81939969..81940067 TGCAGATGAGGAATGAGTCG Chr15:81940005..81940024 59.94 50
upstream ENSMUSE00000556673 Chr15:81942874..81942984 GATATCCTGCAGCCCTCCTT Chr15:81942912..81942931 60.57 55
upstream ENSMUSE00000556671 Chr15:81943278..81943441 GCTTGAGCTCCTGGAGAAGA Chr15:81943309..81943328 59.83 55
upstream ENSMUSE00000556670 Chr15:81945869..81945950 GAAGGCTCTCAGCTTTCCAA Chr15:81945907..81945926 59.69 50
upstream ENSMUSE00000556668 Chr15:81946113..81946288 ATCAACCGCTGTCAACTCCT Chr15:81946191..81946210 59.73 50

*** Putative Vector Insertion (Chr 15: 81946289 - 81953851) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000556667 Chr15:81953852..81953933 CAGCCAATACAGGCTTGAGA Chr15:81953889..81953908 59.02 50
downstream ENSMUSE00000556665 Chr15:81954328..81954434 AACAGCAGAAACCGATTCCA Chr15:81954373..81954392 60.64 45
downstream ENSMUSE00000556663 Chr15:81955280..81955411 TTCACGTGAGAGGACACAGC Chr15:81955321..81955340 60.03 55
downstream ENSMUSE00000556661 Chr15:81955583..81955695 GATTGCAAGGTCTGGGTCAT Chr15:81955638..81955657 59.93 50
downstream ENSMUSE00000556659 Chr15:81957044..81957241 CATTATGCCCGGAATTTGTC Chr15:81957158..81957177 60.15 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATTGGGCTCCAGAACCTCT Chr15:81952262..81952282 60.07 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTGGGCTCCAGAACCTCT Chr15:81952262..81952282 60.07 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068117