Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32283
Trapped Gene
Ceacam1 (ENSMUSG00000074272)
Vector Insertion
Chr 7: 26246720 - 26249900
Public Clones IST10255H4 (tigm) IST10255H2 (tigm) IST10255H1 (tigm) IST13129F6 (tigm)
IST10255H2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636396 (Chr7:26249868..26249899 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636396 (Chr7:26249868..26249899 -)
Downstram Exon
ENSMUSE00000514051 (Chr7:26246721..26248919 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CAGAGGGTGTGCCTTAGCTC Chr7:26246946..26246965 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000475696 Chr7:26262490..26262644 TCAGCACATCTCCACAAAGG Chr7:26262522..26262541 59.83 50
upstream ENSMUSE00000636443 Chr7:26261363..26261722 GGATCCCTGCTCTTCCAAAT Chr7:26261455..26261474 60.41 50
upstream ENSMUSE00000636408 Chr7:26259539..26259823 ATGTGTGTGAAACCCGGAAT Chr7:26259585..26259604 60.1 45
upstream ENSMUSE00000463363 Chr7:26258817..26259071 CGGAACCTATACCTGCTTCG Chr7:26258874..26258893 59.72 55
upstream ENSMUSE00000636437 Chr7:26256817..26257092 CTGACCTGCTTGTCGAATGA Chr7:26257008..26257027 59.98 50
upstream ENSMUSE00000636404 Chr7:26251336..26251456 CATCGTGATTGGAGTTGTGG Chr7:26251394..26251413 59.96 50
upstream ENSMUSE00000636399 Chr7:26250487..26250539 GCGAGATCTCACAGAGCACA Chr7:26250508..26250527 60.3 55
upstream ENSMUSE00000636428 Chr7:26250487..26250539 GCGAGATCTCACAGAGCACA Chr7:26250508..26250527 60.3 55
upstream ENSMUSE00000636396 Chr7:26249868..26249899 No primer for this exon
upstream ENSMUSE00000636423 Chr7:26249868..26249899 No primer for this exon
upstream ENSMUSE00000676633 Chr7:26249868..26249899 No primer for this exon
upstream ENSMUSE00000514051 Chr7:26246721..26248919 GAGCTAAGGCACACCCTCTG Chr7:26246968..26246987 60.01 60
upstream ENSMUSE00000535853 Chr7:26246721..26248919 GAGCTAAGGCACACCCTCTG Chr7:26246968..26246987 60.01 60
upstream ENSMUSE00000636393 Chr7:26246721..26248919 GAGCTAAGGCACACCCTCTG Chr7:26246968..26246987 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCCCTAGATCTGGCTCCT Chr7:26246887..26246907 59.79 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACACGTGACTGGGAAAACC Chr7:26246833..26246853 61.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074272