Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32301
Trapped Gene
Irak4 (ENSMUSG00000059883)
Vector Insertion
Chr 15: 94393512 - 94397169
Public Clones IST12349G1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000552782 (Chr15:94393449..94393511 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGATGAAAACCGTGAACC Chr15:94393482..94393501 60.22 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000552782 (Chr15:94393449..94393511 +)
Downstram Exon
ENSMUSE00000552780 (Chr15:94397170..94397328 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGATGAAAACCGTGAACC Chr15:94393482..94393501 60.22 50 AATGTCTGGCCGTCTGTTTT Chr15:94397325..94397344 59.6 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000505342 Chr15:94374091..94374257 GATCGCAGGCAGTCTGAAGT Chr15:94374141..94374160 60.56 55
upstream ENSMUSE00000621735 Chr15:94374103..94374257 GATCGCAGGCAGTCTGAAGT Chr15:94374141..94374160 60.56 55
upstream ENSMUSE00000490225 Chr15:94378267..94378434 GGCGACGACAGATACAATCA Chr15:94378403..94378422 59.68 50
upstream ENSMUSE00000719152 Chr15:94378267..94378434 GGCGACGACAGATACAATCA Chr15:94378403..94378422 59.68 50
upstream ENSMUSE00000706227 Chr15:94378274..94378434 GGCGACGACAGATACAATCA Chr15:94378403..94378422 59.68 50
upstream ENSMUSE00000495681 Chr15:94382234..94382379 TACTTCAGACCGGGAAGAGC Chr15:94382248..94382267 59.43 55
upstream ENSMUSE00000483203 Chr15:94384266..94384306 GTTCCCCAAACCGTCAAAAG Chr15:94384271..94384290 61.62 50
upstream ENSMUSE00000484115 Chr15:94384266..94384448 ATGCCTATGCCGAAGCTAGA Chr15:94384364..94384383 59.97 50
upstream ENSMUSE00000488130 Chr15:94384309..94384410 ATGCCTATGCCGAAGCTAGA Chr15:94384364..94384383 59.97 50
upstream ENSMUSE00000489176 Chr15:94384412..94384448 No primer for this exon
upstream ENSMUSE00000552797 Chr15:94385117..94385277 CACAGCTTCTCGTTCCATGA Chr15:94385122..94385141 59.98 50
upstream ENSMUSE00000621734 Chr15:94385117..94385217 CACAGCTTCTCGTTCCATGA Chr15:94385122..94385141 59.98 50
upstream ENSMUSE00000552794 Chr15:94387058..94387122 No primer for this exon
upstream ENSMUSE00000552790 Chr15:94388681..94388795 ACAGCGACAACCTGTGCTTA Chr15:94388725..94388744 59.51 50
upstream ENSMUSE00000552787 Chr15:94389200..94389309 GATGGTACACCACCGCTTTC Chr15:94389200..94389219 60.38 55
upstream ENSMUSE00000552786 Chr15:94391877..94392060 GCTTTGCGGGGAGAAATAAC Chr15:94392010..94392029 60.93 50
upstream ENSMUSE00000552782 Chr15:94393449..94393511 GTGGATGAAAACCGTGAACC Chr15:94393482..94393501 60.22 50

*** Putative Vector Insertion (Chr 15: 94393512 - 94397169) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000552780 Chr15:94397170..94397328 AATGTCTGGCCGTCTGTTTT Chr15:94397325..94397344 59.6 45
downstream ENSMUSE00000679618 Chr15:94397400..94397411 No primer for this exon
downstream ENSMUSE00000476113 Chr15:94397445..94398737 TTTACTTCAGCGGGAGCAGT Chr15:94398450..94398469 60.01 50
downstream ENSMUSE00000679619 Chr15:94410319..94412246 CAGAGTGCCCTGTCTTAGCC Chr15:94411244..94411263 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTCTTTAATCGCCTTGCAG Chr15:94393557..94393577 59.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTTCGTGACTGGGAAAACC Chr15:94393559..94393579 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059883