Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32306
Trapped Gene
Uty (ENSMUSG00000068457)
Vector Insertion
Chr Y: 471314 - 473440
Public Clones IST13054C6 (tigm) IST14446A3 (tigm) IST14675F8 (tigm) IST10851G5 (tigm)
IST11054C2 (tigm) IST13934E4 (tigm) IST12058G2 (tigm) IST11552A9 (tigm)
IST10286D5 (tigm) IST14790H12 (tigm) IST12295G3 (tigm) IST10382C11 (tigm)
IST12875D3 (tigm) IST13360G2 (tigm) IST10609D10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000626500 (ChrY:473291..473439 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTGACAAAGCTTCCTGCT ChrY:473400..473419 59.38 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000626500 (ChrY:473291..473439 -)
Downstram Exon
ENSMUSE00000626499 (ChrY:471315..471429 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTGACAAAGCTTCCTGCT ChrY:473400..473419 59.38 50 TTCACAATCACCTGGACCAA ChrY:471346..471365 59.94 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000577901 ChrY:581850..582181 GAAGGCGCTTTGTGGATTAG ChrY:581854..581873 59.85 50
upstream ENSMUSE00000626519 ChrY:581599..581662 CAGCTTCTTCGGGTTCTTGA ChrY:581643..581662 60.51 50
upstream ENSMUSE00000626518 ChrY:576154..576262 GCTGAAGGAAAAGTGGAATCAG ChrY:576208..576229 60.24 45.46
upstream ENSMUSE00000626517 ChrY:560940..560989 No primer for this exon
upstream ENSMUSE00000626516 ChrY:535898..535956 No primer for this exon
upstream ENSMUSE00000626515 ChrY:533649..533769 TTTTTGCAGAGCCAAAGAAA ChrY:533708..533727 58.67 35
upstream ENSMUSE00000626514 ChrY:525779..525833 GGCCCTGATCGACTGTAATG ChrY:525803..525822 60.48 55
upstream ENSMUSE00000626513 ChrY:523217..523251 No primer for this exon
upstream ENSMUSE00000626512 ChrY:512934..513027 TTGCCATCACAAGTCAAAGC ChrY:512954..512973 59.85 45
upstream ENSMUSE00000626511 ChrY:511171..511297 No primer for this exon
upstream ENSMUSE00000441428 ChrY:510235..510271 No primer for this exon
upstream ENSMUSE00000626510 ChrY:507347..507445 GGAAGGTTCAGGATGCCTTT ChrY:507409..507428 60.44 50
upstream ENSMUSE00000626509 ChrY:506408..506627 CAGCTCGGAGCAAATCTTGT ChrY:506450..506469 60.54 50
upstream ENSMUSE00000626508 ChrY:505566..505700 CAATACCCGCAGAGCTTACC ChrY:505599..505618 59.73 55
upstream ENSMUSE00000626507 ChrY:504533..504628 TGTCCAGACAGCTTCACATCA ChrY:504585..504605 60.46 47.62
upstream ENSMUSE00000626506 ChrY:494350..495077 CCATTTCAAACTGGGTCCAC ChrY:495034..495053 60.21 50
upstream ENSMUSE00000626505 ChrY:490598..490727 ACCACCAACTTCGCCATATC ChrY:490645..490664 59.82 50
upstream ENSMUSE00000626504 ChrY:489212..489317 ACAGTAATTCGCGGTCTTGC ChrY:489229..489248 60.28 50
upstream ENSMUSE00000626503 ChrY:488391..488596 AACTGGGATCCCTCTGGAAC ChrY:488485..488504 60.31 55
upstream ENSMUSE00000626502 ChrY:474250..474314 No primer for this exon
upstream ENSMUSE00000626501 ChrY:474101..474175 TCTGGAAGGAGACAGAAAGCA ChrY:474154..474174 60.12 47.62
upstream ENSMUSE00000626500 ChrY:473291..473439 AGCTGACAAAGCTTCCTGCT ChrY:473400..473419 59.38 50
upstream ENSMUSE00000626499 ChrY:471315..471429 TGGGGTGTTCTGAATGACTTC ChrY:471323..471343 59.96 47.62

*** Putative Vector Insertion (Chr Y: 471314 - 473440) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000626498 ChrY:467479..467666 CAGTGCCTGCATTTATCCAA ChrY:467520..467539 59.69 45
downstream ENSMUSE00000626497 ChrY:466313..466454 No primer for this exon
downstream ENSMUSE00000626496 ChrY:439208..439334 CCATGCCACAAAACCTCTTT ChrY:439229..439248 59.97 45
downstream ENSMUSE00000568719 ChrY:436025..436195 TTTCGTGCACAGTTCTGACA ChrY:436088..436107 59 45
downstream ENSMUSE00000704564 ChrY:433587..435016 TGCGTAAGTCTCCCAACACA ChrY:433592..433611 60.3 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTATTGCAGGTGGAAGTTGC ChrY:473427..473448 60.12 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTGCTTTTGTACGTCGTG ChrY:473385..473405 59.9 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068457