Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32314
Trapped Gene
AC138113.3-202 (ENSMUSG00000072609)
Vector Insertion
Chr 14: 42873449 - 43017331
Public Clones (sanger) IST14576F3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 58% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000689358 (Chr14:43017168..43017330 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGGAATCCTGGCCAACTAC Chr14:43017191..43017210 60.33 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000689358 (Chr14:43017168..43017330 -)
Downstram Exon
ENSMUSE00000649513 (Chr14:42873450..42873581 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGGAATCCTGGCCAACTAC Chr14:43017191..43017210 60.33 55 CTGGGGCATACACTTCAGGT Chr14:42873487..42873506 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000689360 Chr14:43018325..43018480 TCCATGCTCCTCAGGGTATT Chr14:43018427..43018446 59.51 50
upstream ENSMUSE00000689358 Chr14:43017168..43017330 AGGGAATCCTGGCCAACTAC Chr14:43017191..43017210 60.33 55
upstream ENSMUSE00000649513 Chr14:42873450..42873581 AGGACATCAGTGAGGCCTTG Chr14:42873491..42873510 60.26 55

*** Putative Vector Insertion (Chr 14: 42873449 - 43017331) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000649512 Chr14:42872700..42872793 TTCAATCAGGAGGTGGCAGT Chr14:42872744..42872763 60.66 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCATCCTTTTCTGCCTGCTT Chr14:42906308..42906328 59.96 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGAACAGGATCGTGACTGG Chr14:42906271..42906291 59.1 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000072609