Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32321
Trapped Gene
Vnn3 (ENSMUSG00000020010)
Vector Insertion
Chr 10: 23576197 - 23584143
Public Clones (sanger) (sanger) IST10763F6 (tigm) IST14508B4 (tigm) IST11170E7 (tigm)
IST11526B8 (tigm) IST11531D6 (tigm) IST12075D8 (tigm) IST12101E8 (tigm)
IST10421F5 (tigm) IST12157C12 (tigm) IST12618D8 (tigm) IST10830D7 (tigm)
IST13597C11 (tigm) IST10664A2 (tigm) IST11636F7 (tigm) IST14993G5 (tigm)
IST15065H6 (tigm) IST12680A9 (tigm) IST10537B2 (tigm) IST12166H3 (tigm)
IST11142D6 (tigm) IST13499G5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 36% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000099751 (Chr10:23576004..23576196 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000099751 (Chr10:23576004..23576196 +)
Downstram Exon
ENSMUSE00000099747 (Chr10:23584144..23584435 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000099753 Chr10:23571278..23571602 No primer for this exon
upstream ENSMUSE00000099748 Chr10:23571713..23571843 No primer for this exon
upstream ENSMUSE00000099751 Chr10:23576004..23576196 No primer for this exon

*** Putative Vector Insertion (Chr 10: 23576197 - 23584143) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000099747 Chr10:23584144..23584435 No primer for this exon
downstream ENSMUSE00000099746 Chr10:23585434..23585804 No primer for this exon
downstream ENSMUSE00000099750 Chr10:23586900..23587073 No primer for this exon
downstream ENSMUSE00000396559 Chr10:23589335..23589637 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCTCATAATCGCCTTGCAG Chr10:23579242..23579262 60.24 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACCTCACGTGACTGGGAAA Chr10:23579241..23579261 59.13 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020010