Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32329
Trapped Gene
Th (ENSMUSG00000000214)
Vector Insertion
Chr 7: 150085776 - 150116529
Public Clones IST10498C4 (tigm) IST10371C9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000668006 (Chr7:150116499..150116528 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000668006 (Chr7:150116499..150116528 -)
Downstram Exon
ENSMUSE00000206378 (Chr7:150085777..150085871 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000668006 Chr7:150116499..150116528 No primer for this exon
upstream ENSMUSE00000206378 Chr7:150085777..150085871 No primer for this exon

*** Putative Vector Insertion (Chr 7: 150085776 - 150116529) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000206369 Chr7:150083871..150084095 No primer for this exon
downstream ENSMUSE00000206377 Chr7:150082833..150083007 No primer for this exon
downstream ENSMUSE00000206370 Chr7:150082499..150082587 No primer for this exon
downstream ENSMUSE00000206374 Chr7:150082316..150082383 No primer for this exon
downstream ENSMUSE00000206382 Chr7:150081934..150081984 No primer for this exon
downstream ENSMUSE00000206371 Chr7:150081428..150081573 No primer for this exon
downstream ENSMUSE00000206380 Chr7:150081222..150081357 No primer for this exon
downstream ENSMUSE00000206379 Chr7:150080994..150081063 No primer for this exon
downstream ENSMUSE00000206381 Chr7:150080546..150080602 No primer for this exon
downstream ENSMUSE00000225064 Chr7:150080298..150080393 No primer for this exon
downstream ENSMUSE00000206375 Chr7:150079913..150080046 No primer for this exon
downstream ENSMUSE00000225049 Chr7:150078681..150079095 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGTGGGACCCTGTGATAGC Chr7:150089504..150089524 60.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTCAAGACCCTCGTGACTG Chr7:150092470..150092490 60.85 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000214