Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32335
Trapped Gene
CR956641.9 (ENSMUSG00000083534)
Vector Insertion
Chr 17: 37107265 - 37108059
Public Clones PST25445-NR (escells) IST11671C10 (tigm) IST11502D10 (tigm) IST10115G1 (tigm)
IST10115B5 (tigm) IST14866C6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000711268 (Chr17:37107786..37108058 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAGTTTATGCGCTTTGACA Chr17:37107945..37107964 60.02 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000711268 (Chr17:37107786..37108058 -)
Downstram Exon
ENSMUSE00000717541 (Chr17:37107266..37107542 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAGTTTATGCGCTTTGACA Chr17:37107945..37107964 60.02 45 CTCCAAGTGCCTCAGTAGCC Chr17:37107272..37107291 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718339 Chr17:37108263..37108341 TCCAGACCAAGAACCAGAGC Chr17:37108264..37108283 60.39 55
upstream ENSMUSE00000711268 Chr17:37107786..37108058 GCAGTTTATGCGCTTTGACA Chr17:37107945..37107964 60.02 45
upstream ENSMUSE00000717541 Chr17:37107266..37107542 GGCAGAAGGTGTAGCAGAGG Chr17:37107351..37107370 60.01 60

*** Putative Vector Insertion (Chr 17: 37107265 - 37108059) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000719869 Chr17:37106385..37106666 CTGGTCTCCACAAGGTCCAT Chr17:37106484..37106503 59.96 55
downstream ENSMUSE00000719236 Chr17:37106140..37106262 CCCCAAGGAGAACTACACCA Chr17:37106184..37106203 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACATTCCTTGCGGTATTTGG Chr17:37108033..37108053 59.82 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACATTCCTTGCGGTATTTGG Chr17:37108033..37108053 59.82 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000083534