Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32337
Trapped Gene
Scgb1c1 (ENSMUSG00000038801)
Vector Insertion
Chr 7: 148031531 - 148031946
Public Clones IST10048F12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000235560 (Chr7:148031476..148031530 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000235560 (Chr7:148031476..148031530 +)
Downstram Exon
ENSMUSE00000333540 (Chr7:148031947..148032146 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGGCCCTTCGTAGAGTTCTT Chr7:148032041..148032060 59.71 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000235560 Chr7:148031476..148031530 No primer for this exon

*** Putative Vector Insertion (Chr 7: 148031531 - 148031946) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000333540 Chr7:148031947..148032146 GGGCCCTTCGTAGAGTTCTT Chr7:148032041..148032060 59.71 55
downstream ENSMUSE00000526256 Chr7:148032499..148032667 CGTGTTTCGGGTCTGCTTAT Chr7:148032550..148032569 60.13 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGGCCTTGTTTCTAGCAC Chr7:148031538..148031558 59.88 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGGCCTTGTTTCTAGCAC Chr7:148031538..148031558 59.88 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038801