Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3234
Trapped Gene
Nedd4l (ENSMUSG00000024589)
Vector Insertion
Chr 18: 65365348 - 65367702
Public Clones AL0669 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000318611 (Chr18:65365287..65365347 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAGGGTCCAGAAGCAAATG Chr18:65365313..65365332 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000318611 (Chr18:65365287..65365347 +)
Downstram Exon
ENSMUSE00000572284 (Chr18:65367703..65367762 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAGGGTCCAGAAGCAAATG Chr18:65365313..65365332 60.11 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000444297 Chr18:65080790..65080921 AGTTCATGTGGGGGACAAAG Chr18:65080810..65080829 59.82 50
upstream ENSMUSE00000444290 Chr18:65157002..65157075 GAATTGACCTCGCCAAGAAG Chr18:65157039..65157058 59.81 50
upstream ENSMUSE00000625273 Chr18:65183548..65183643 CGCTCCCTTTTAGAGGAGGT Chr18:65183606..65183625 59.84 55
upstream ENSMUSE00000572286 Chr18:65210696..65210826 CAACACCAGTCCAACAGCAC Chr18:65210768..65210787 60.2 55
upstream ENSMUSE00000490598 Chr18:65234378..65234459 ACCCATACGTGAAGCTGTCC Chr18:65234380..65234399 60 55
upstream ENSMUSE00000625272 Chr18:65234378..65234459 ACCCATACGTGAAGCTGTCC Chr18:65234380..65234399 60 55
upstream ENSMUSE00000404722 Chr18:65237352..65237390 TGAACCCAAAGTGGAATGAAG Chr18:65237356..65237376 59.96 42.86
upstream ENSMUSE00000625271 Chr18:65237352..65237390 TGAACCCAAAGTGGAATGAAG Chr18:65237356..65237376 59.96 42.86
upstream ENSMUSE00000444257 Chr18:65239672..65239725 No primer for this exon
upstream ENSMUSE00000625270 Chr18:65239672..65239725 No primer for this exon
upstream ENSMUSE00000403425 Chr18:65303450..65303500 GGTGGACGTGCCTCTTAGTC Chr18:65303473..65303492 59.73 60
upstream ENSMUSE00000625269 Chr18:65303450..65303500 GGTGGACGTGCCTCTTAGTC Chr18:65303473..65303492 59.73 60
upstream ENSMUSE00000444212 Chr18:65314910..65314971 CCAACCATGGAGAGACCCTA Chr18:65314919..65314938 59.92 55
upstream ENSMUSE00000572288 Chr18:65314910..65314971 CCAACCATGGAGAGACCCTA Chr18:65314919..65314938 59.92 55
upstream ENSMUSE00000143543 Chr18:65315300..65315402 TGAAGAAAACAGCGAGCAGA Chr18:65315369..65315388 59.86 45
upstream ENSMUSE00000143550 Chr18:65317499..65317665 ATGGGAAGTGGTTGACTCCA Chr18:65317504..65317523 60.36 50
upstream ENSMUSE00000143546 Chr18:65321169..65321304 TGTGTCCTCGGAATCAGACA Chr18:65321172..65321191 60.25 50
upstream ENSMUSE00000318921 Chr18:65322649..65322825 AGGAGCTGTCGGAAGAAGTG Chr18:65322749..65322768 59.6 55
upstream ENSMUSE00000318885 Chr18:65325226..65325300 CAGTGTTACCGACACGGTTG Chr18:65325258..65325277 60.06 55
upstream ENSMUSE00000318861 Chr18:65327168..65327227 No primer for this exon
upstream ENSMUSE00000143539 Chr18:65331929..65332060 TTCAGGCTGGGAAGAAAGAA Chr18:65331967..65331986 59.93 45
upstream ENSMUSE00000143557 Chr18:65332570..65332689 CGGATCAGCCACAAACAGTA Chr18:65332590..65332609 59.72 50
upstream ENSMUSE00000143561 Chr18:65333699..65333896 AGATGAGGATAGCCCCCAAC Chr18:65333832..65333851 60.29 55
upstream ENSMUSE00000143554 Chr18:65338573..65338650 CCAGTACACATGCGGTCAAA Chr18:65338594..65338613 60.57 50
upstream ENSMUSE00000143558 Chr18:65340982..65341036 GCCGCACGTTTTACATTGAC Chr18:65341013..65341032 61.46 50
upstream ENSMUSE00000143542 Chr18:65345980..65346038 GACTACAGAACCCAGCCATCA Chr18:65346010..65346030 60.13 52.38
upstream ENSMUSE00000143553 Chr18:65351091..65351156 GCTGTTCCGTACTCCAGAGAG Chr18:65351091..65351111 59.1 57.14
upstream ENSMUSE00000318699 Chr18:65352730..65352959 AAGGCTAGGCTGTGGATTGA Chr18:65352829..65352848 59.84 50
upstream ENSMUSE00000143545 Chr18:65354714..65354835 TCAGATCAATCCCAACTCAGG Chr18:65354729..65354749 60.06 47.62
upstream ENSMUSE00000472197 Chr18:65355569..65355639 GCAGATAACGCTGAACGACA Chr18:65355609..65355628 60.02 50
upstream ENSMUSE00000572285 Chr18:65358285..65358380 No primer for this exon
upstream ENSMUSE00000347968 Chr18:65363530..65363603 CCCAACGGGTCAGAAATAAT Chr18:65363551..65363570 58.76 45
upstream ENSMUSE00000318611 Chr18:65365287..65365347 ACAGGGTCCAGAAGCAAATG Chr18:65365313..65365332 60.11 50

*** Putative Vector Insertion (Chr 18: 65365348 - 65367702) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000572284 Chr18:65367703..65367762 No primer for this exon
downstream ENSMUSE00000143541 Chr18:65368046..65368153 TGCTGTCTCCAGTCGTTCAC Chr18:65368098..65368117 60.03 55
downstream ENSMUSE00000143555 Chr18:65369307..65369403 AGTTCGGCAAATCCATTCAT Chr18:65369401..65369420 59.39 40
downstream ENSMUSE00000143548 Chr18:65369917..65369989 TGGGTAGTTTTTCGGGACTG Chr18:65369979..65369998 59.96 50
downstream ENSMUSE00000625268 Chr18:65372438..65372961 ATCAGTGTACACGGCAACCA Chr18:65372766..65372785 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGAGGTAAGCCCTGCTAA Chr18:65365343..65365363 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGAGGTAAGCCCTGCTAA Chr18:65365343..65365363 59.84 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024589