Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32341
Trapped Gene
Osbpl3 (ENSMUSG00000029822)
Vector Insertion
Chr 6: 50262630 - 50270174
Public Clones IST13055A3 (tigm) IST11921F5 (tigm) IST10120G4 (tigm) IST12341D7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000193092 (Chr6:50270036..50270173 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTTAACCCGGTCCTTGGAG Chr6:50270089..50270108 60.71 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000193092 (Chr6:50270036..50270173 -)
Downstram Exon
ENSMUSE00000193077 (Chr6:50262631..50262694 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTTAACCCGGTCCTTGGAG Chr6:50270089..50270108 60.71 55 ACAAAGTTTCCGGACTCAGC Chr6:50262620..50262639 59.33 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000617161 Chr6:50405824..50406081 TCCTTCTCGGTCTGAAGCAC Chr6:50405867..50405886 60.53 55
upstream ENSMUSE00000506925 Chr6:50378328..50378419 CTGTCCTGTGTCAGCGAAGA Chr6:50378398..50378417 60.18 55
upstream ENSMUSE00000481934 Chr6:50332789..50332836 TGCATACTTTACCGCAGTGG Chr6:50332794..50332813 59.75 50
upstream ENSMUSE00000277002 Chr6:50320122..50320357 GCCTGCGAGGACTTCATACT Chr6:50320279..50320298 59.46 55
upstream ENSMUSE00000699462 Chr6:50320122..50320214 CGAGAAGAATCTCGGTGTGTC Chr6:50320186..50320206 59.86 52.38
upstream ENSMUSE00000193079 Chr6:50302984..50303100 CCTTAAAAGGCTGGCACAAG Chr6:50302984..50303003 59.88 50
upstream ENSMUSE00000193100 Chr6:50302783..50302836 ATATGCCAAGAGCCAAGCTG Chr6:50302785..50302804 60.37 50
upstream ENSMUSE00000193088 Chr6:50301843..50301956 ATCGACCTAGACACGGAGGA Chr6:50301862..50301881 59.68 55
upstream ENSMUSE00000276969 Chr6:50297970..50298137 AATGAGATCGCCATGTTTCC Chr6:50298052..50298071 59.9 45
upstream ENSMUSE00000276960 Chr6:50297365..50297488 GCGACACTCGAGTTCCTTTC Chr6:50297405..50297424 60 55
upstream ENSMUSE00000276950 Chr6:50296327..50296430 ACGTCCTGCATCGGACATAC Chr6:50296354..50296373 60.96 55
upstream ENSMUSE00000561528 Chr6:50296010..50296102 AGGAAAAACGACCACACAGG Chr6:50296058..50296077 60.01 50
upstream ENSMUSE00000193078 Chr6:50294873..50295029 GACGCTGGACTTTGGAGAAG Chr6:50294954..50294973 59.99 55
upstream ENSMUSE00000193106 Chr6:50286214..50286344 AAGGTCGGCTTTCAATAGCA Chr6:50286312..50286331 59.85 45
upstream ENSMUSE00000193084 Chr6:50283185..50283292 AACGCTTACGCAGAATCCAT Chr6:50283245..50283264 59.74 45
upstream ENSMUSE00000193099 Chr6:50278669..50278803 GGCTGTCTATCACCGACTCC Chr6:50278729..50278748 59.69 60
upstream ENSMUSE00000193110 Chr6:50277374..50277467 No primer for this exon
upstream ENSMUSE00000193087 Chr6:50272972..50273222 GGAATACAGCGAGCTTCTGG Chr6:50273010..50273029 59.98 55
upstream ENSMUSE00000193092 Chr6:50270036..50270173 GTTTAACCCGGTCCTTGGAG Chr6:50270089..50270108 60.71 55
upstream ENSMUSE00000193077 Chr6:50262631..50262694 GCTGAGTCCGGAAACTTTGT Chr6:50262642..50262661 59.33 50

*** Putative Vector Insertion (Chr 6: 50262630 - 50270174) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000193074 Chr6:50259312..50259390 TTCCATGGATTTACCCCAGA Chr6:50259328..50259347 60.13 45
downstream ENSMUSE00000699468 Chr6:50259312..50259388 TTCCATGGATTTACCCCAGA Chr6:50259328..50259347 60.13 45
downstream ENSMUSE00000193086 Chr6:50258290..50258434 TGTCAATTTCGCCATAGTGC Chr6:50258318..50258337 59.69 45
downstream ENSMUSE00000193109 Chr6:50253016..50253160 AGATGCTCTCGTGCCATTTC Chr6:50253036..50253055 60.37 50
downstream ENSMUSE00000193082 Chr6:50250923..50251049 GAGTGTCGGTGGGTGGTAAT Chr6:50250920..50250939 59.7 55
downstream ENSMUSE00000193111 Chr6:50249315..50249437 CTCTGCAGCTTCTCGATCCT Chr6:50249350..50249369 59.85 55
downstream ENSMUSE00000699460 Chr6:50247064..50247160 TCACCATAAGACGGGATGGT Chr6:50247042..50247061 60.19 50
downstream ENSMUSE00000699463 Chr6:50246806..50247160 TCAGCGCTTACAATGCTACG Chr6:50246909..50246928 60.18 50
downstream ENSMUSE00000193108 Chr6:50246800..50247160 TCAGCGCTTACAATGCTACG Chr6:50246909..50246928 60.18 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACTGCCAATATGACTGCT Chr6:50267198..50267218 58.91 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCACTGCCAATATGACTGCT Chr6:50267198..50267218 58.91 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029822