Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3235
Trapped Gene
Tmem87b (ENSMUSG00000014353)
Vector Insertion
Chr 2: 128663132 - 128664883
Public Clones AL0595 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 62% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000169056 (Chr2:128663038..128663131 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000169056 (Chr2:128663038..128663131 +)
Downstram Exon
ENSMUSE00000169036 (Chr2:128664884..128664955 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683545 Chr2:128643854..128644239 No primer for this exon
upstream ENSMUSE00000382728 Chr2:128644039..128644239 No primer for this exon
upstream ENSMUSE00000315378 Chr2:128648819..128648879 No primer for this exon
upstream ENSMUSE00000683529 Chr2:128648819..128648879 No primer for this exon
upstream ENSMUSE00000315370 Chr2:128650152..128650246 No primer for this exon
upstream ENSMUSE00000169060 Chr2:128651993..128652124 No primer for this exon
upstream ENSMUSE00000169058 Chr2:128654142..128654192 No primer for this exon
upstream ENSMUSE00000169032 Chr2:128656246..128656336 No primer for this exon
upstream ENSMUSE00000169047 Chr2:128656934..128656995 No primer for this exon
upstream ENSMUSE00000169057 Chr2:128657186..128657369 No primer for this exon
upstream ENSMUSE00000169049 Chr2:128659851..128659950 No primer for this exon
upstream ENSMUSE00000169056 Chr2:128663038..128663131 No primer for this exon

*** Putative Vector Insertion (Chr 2: 128663132 - 128664883) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000169036 Chr2:128664884..128664955 No primer for this exon
downstream ENSMUSE00000683528 Chr2:128664884..128664990 No primer for this exon
downstream ENSMUSE00000683536 Chr2:128666971..128667079 No primer for this exon
downstream ENSMUSE00000169054 Chr2:128666982..128667079 No primer for this exon
downstream ENSMUSE00000169043 Chr2:128667161..128667219 No primer for this exon
downstream ENSMUSE00000169034 Chr2:128668332..128668435 No primer for this exon
downstream ENSMUSE00000169045 Chr2:128671197..128671270 No primer for this exon
downstream ENSMUSE00000169059 Chr2:128672465..128672535 No primer for this exon
downstream ENSMUSE00000169033 Chr2:128674741..128674793 No primer for this exon
downstream ENSMUSE00000169051 Chr2:128676040..128676070 No primer for this exon
downstream ENSMUSE00000641218 Chr2:128677020..128679996 No primer for this exon
downstream ENSMUSE00000683530 Chr2:128677020..128679997 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTCACCCCTTTTGTTGCTG Chr2:128663152..128663172 60.15 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTCACCCCTTTTGTTGCTG Chr2:128663152..128663172 60.15 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014353