Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32352
Trapped Gene
Msra (ENSMUSG00000054733)
Vector Insertion
Chr 14: 64932523 - 65059864
Public Clones PST18272-NR (escells) IST14960G2 (tigm) IST14820A10 (tigm) IST12042E9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000424013 (Chr14:65059547..65059863 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGACTCAGCTTCGAAAGTC Chr14:65059599..65059618 60.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000424013 (Chr14:65059547..65059863 -)
Downstram Exon
ENSMUSE00000497089 (Chr14:64932524..64932592 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGACTCAGCTTCGAAAGTC Chr14:65059599..65059618 60.28 55 TTGCCACTGACATGGTGTTT Chr14:64932549..64932568 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000557621 Chr14:65074719..65074740 No primer for this exon
upstream ENSMUSE00000557620 Chr14:65073596..65073730 CCAAGGCTGGAATGACTTCT Chr14:65073641..65073660 59.28 50
upstream ENSMUSE00000557619 Chr14:65072299..65072400 CACCGTTTGAAGAAGTGCTG Chr14:65072375..65072394 59.49 50
upstream ENSMUSE00000557617 Chr14:65071234..65071312 AGATTAGCAAGGTCGGATGG Chr14:65071270..65071289 59.15 50
upstream ENSMUSE00000557616 Chr14:65069801..65069875 GCTCAGCTTCGAGATCTTCCT Chr14:65069818..65069838 60.25 52.38
upstream ENSMUSE00000424013 Chr14:65059547..65059863 GCGACTCAGCTTCGAAAGTC Chr14:65059599..65059618 60.28 55
upstream ENSMUSE00000497089 Chr14:64932524..64932592 ATGTCAGTGGCAACAGAACG Chr14:64932564..64932583 59.75 50

*** Putative Vector Insertion (Chr 14: 64932523 - 65059864) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000424024 Chr14:64903901..64904020 AAGCCCACTTGGGTTGAGTA Chr14:64903926..64903945 59.59 50
downstream ENSMUSE00000424002 Chr14:64852666..64852770 GTACACAACCCGGACGACTT Chr14:64852711..64852730 59.89 55
downstream ENSMUSE00000423996 Chr14:64829265..64829371 GACTGCTGACCGGTACTGTG Chr14:64829303..64829322 59.34 60
downstream ENSMUSE00000423991 Chr14:64741466..64742190 ACACTTGTCCCTCTCGGATG Chr14:64742111..64742130 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCATCAACCTGGATTCCATC Chr14:64966873..64966893 60.29 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCATCAACCTGGATTCCATC Chr14:64966873..64966893 60.29 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054733