Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32360
Trapped Gene
Spef1 (ENSMUSG00000027329)
Vector Insertion
Chr 2: 130995996 - 130997762
Public Clones IST12807D5 (tigm) IST14346E7 (tigm) IST14338A8 (tigm) IST12807D5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000168457 (Chr2:130997638..130997761 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCCTCCAGATCGCTGAAAA Chr2:130997675..130997694 60.34 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000168457 (Chr2:130997638..130997761 -)
Downstram Exon
ENSMUSE00000339530 (Chr2:130995997..130997526 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCCTCCAGATCGCTGAAAA Chr2:130997675..130997694 60.34 50 TTGGGAGATCATGCGATGTA Chr2:130997122..130997141 60.03 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000456952 Chr2:131012927..131013018 GCAGGACTGAGAGCTGAACC Chr2:131012947..131012966 60.14 60
upstream ENSMUSE00000393189 Chr2:131000301..131000518 TATCTGAACGCTCGCAGTTG Chr2:131000486..131000505 60.16 50
upstream ENSMUSE00000683134 Chr2:131000301..131000546 CGAATAGGGACCCAAACGTA Chr2:131000506..131000525 59.82 50
upstream ENSMUSE00000355277 Chr2:130998932..130999043 CAAGATGGTGGAGATGCACA Chr2:130998990..130999009 60.69 50
upstream ENSMUSE00000389534 Chr2:130998359..130998515 TGAACTTCTCGGTCCCTGAC Chr2:130998479..130998498 60.24 55
upstream ENSMUSE00000168449 Chr2:130998106..130998145 GCTCCTCAGGATAGCAGTGG Chr2:130998120..130998139 59.97 60
upstream ENSMUSE00000168455 Chr2:130997940..130997994 No primer for this exon
upstream ENSMUSE00000168457 Chr2:130997638..130997761 GTCCTCCAGATCGCTGAAAA Chr2:130997675..130997694 60.34 50
upstream ENSMUSE00000339530 Chr2:130995997..130997526 AAGCGTCTGGAACATCTGCT Chr2:130997489..130997508 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAACCAGGCGCTGTAATCG Chr2:130997705..130997725 60.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCTAAGCTGCTACCCACTG Chr2:130997763..130997783 59.24 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027329